EMAIL THIS PAGE TO A FRIEND

CNGB3

cyclic nucleotide gated channel beta 3

110 Gene Product Result for
Synonyms: ACHM1
UniProtKB ID: Q9NQW8, C9JA51, Q9NRE9
Gene ID:
Human(54714) Summary: This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]
Mouse(30952) cyclic nucleotide gated channel beta 3
Rat(500418) cyclic nucleotide gated channel beta 3
Zebrafish(562675) cyclic nucleotide gated channel beta 3
cow(519225) cyclic nucleotide gated channel beta 3
chicken(428367) cyclic nucleotide gated channel beta 3
domestic cat(101099356) cyclic nucleotide gated channel beta 3
dog(403554) cyclic nucleotide gated channel beta 3
domestic guinea pig(100717520) cyclic nucleotide gated channel beta 3
naked mole-rat(101713302) cyclic nucleotide gated channel beta 3
sheep(100233165) cyclic nucleotide gated channel beta 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019098 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145301 MISSION® esiRNA esiRNA human CNGB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019098 Rosetta Predictions human pricing
XM_001057513 Rosetta Predictions rat pricing
XM_575779 Rosetta Predictions rat pricing
NM_013927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017194 predicted 1675
2 SASI_Hs01_00017195 predicted 1020
3 SASI_Hs01_00017196 predicted 631
4 SASI_Hs01_00017197 predicted 636
5 SASI_Hs02_00352713 predicted 720
6 SASI_Hs01_00017199 predicted 660
7 SASI_Hs01_00017200 predicted 1591
8 SASI_Hs01_00017201 predicted 1928
9 SASI_Hs01_00017203 predicted 1637
10 SASI_Hs02_00352714 predicted 1625
11 SASI_Hs01_00017198 predicted 1626
12 SASI_Hs01_00017202 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286666 predicted 1036
2 SASI_Rn02_00286667 predicted 304
3 SASI_Rn02_00286668 predicted 1564
4 SASI_Rn02_00286669 predicted 930
5 SASI_Rn02_00286670 predicted 1496
6 SASI_Rn02_00286671 predicted 798
7 SASI_Rn02_00286672 predicted 1732
8 SASI_Rn02_00286673 predicted 495
9 SASI_Rn02_00286674 predicted 1106
10 SASI_Rn02_00286675 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404313 predicted 1035
2 SASI_Rn02_00404314 predicted 1087
3 SASI_Rn02_00404315 predicted 1563
4 SASI_Rn02_00404316 predicted 932
5 SASI_Rn02_00404317 predicted 1498
6 SASI_Rn02_00404318 predicted 802
7 SASI_Rn02_00404319 predicted 1732
8 SASI_Rn02_00404320 predicted 1104
9 SASI_Rn02_00404321 predicted 1554
10 SASI_Rn02_00404322 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323023 predicted 1186
2 SASI_Mm01_00052319 predicted 1580
3 SASI_Mm01_00052320 predicted 1832
4 SASI_Mm01_00052321 predicted 1785
5 SASI_Mm01_00052323 predicted 982
6 SASI_Mm01_00052324 predicted 901
7 SASI_Mm01_00052325 predicted 1870
8 SASI_Mm01_00052326 predicted 740
9 SASI_Mm01_00052327 predicted 1591
10 SASI_Mm02_00323024 predicted 547
11 SASI_Mm01_00052322 predicted 1941
12 SASI_Mm01_00052328 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019098
CNGB3 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel beta 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019098.4-642s21c1
Sequence:CCGGAGAGTACTTAAAGCGAATTAACTCGAGTTAATTCGCTTTAAGTACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019098.4-2874s21c1
Sequence:CCGGGGCTAATTGTTCTAGGTTTATCTCGAGATAAACCTAGAACAATTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019098.4-1243s21c1
Sequence:CCGGTATTGGGCAGTTCGAACTTTACTCGAGTAAAGTTCGAACTGCCCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-1685s1c1
Sequence:CCGGCCTGGTGACTTTGTCTGCAAACTCGAGTTTGCAGACAAAGTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-1918s1c1
Sequence:CCGGCCAAGAAATTCTAGTGCATTACTCGAGTAATGCACTAGAATTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-2048s1c1
Sequence:CCGGCCGAAAGAAGAGACACCCAAACTCGAGTTTGGGTGTCTCTTCTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-902s1c1
Sequence:CCGGGATTCAAATGAGCTAAGGAAACTCGAGTTTCCTTAGCTCATTTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-772s1c1
Sequence:CCGGCCCATATCAAACCGCAGACAACTCGAGTTGTCTGCGGTTTGATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019098
CNGB3 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel beta 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019098.4-642s21c1
Sequence:CCGGAGAGTACTTAAAGCGAATTAACTCGAGTTAATTCGCTTTAAGTACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019098.4-2874s21c1
Sequence:CCGGGGCTAATTGTTCTAGGTTTATCTCGAGATAAACCTAGAACAATTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019098.4-1243s21c1
Sequence:CCGGTATTGGGCAGTTCGAACTTTACTCGAGTAAAGTTCGAACTGCCCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-1685s1c1
Sequence:CCGGCCTGGTGACTTTGTCTGCAAACTCGAGTTTGCAGACAAAGTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-1918s1c1
Sequence:CCGGCCAAGAAATTCTAGTGCATTACTCGAGTAATGCACTAGAATTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-2048s1c1
Sequence:CCGGCCGAAAGAAGAGACACCCAAACTCGAGTTTGGGTGTCTCTTCTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-902s1c1
Sequence:CCGGGATTCAAATGAGCTAAGGAAACTCGAGTTTCCTTAGCTCATTTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-772s1c1
Sequence:CCGGCCCATATCAAACCGCAGACAACTCGAGTTGTCTGCGGTTTGATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019098
CNGB3 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel beta 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019098.4-642s21c1
Sequence:CCGGAGAGTACTTAAAGCGAATTAACTCGAGTTAATTCGCTTTAAGTACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019098.4-2874s21c1
Sequence:CCGGGGCTAATTGTTCTAGGTTTATCTCGAGATAAACCTAGAACAATTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019098.4-1243s21c1
Sequence:CCGGTATTGGGCAGTTCGAACTTTACTCGAGTAAAGTTCGAACTGCCCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-1685s1c1
Sequence:CCGGCCTGGTGACTTTGTCTGCAAACTCGAGTTTGCAGACAAAGTCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-1918s1c1
Sequence:CCGGCCAAGAAATTCTAGTGCATTACTCGAGTAATGCACTAGAATTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-2048s1c1
Sequence:CCGGCCGAAAGAAGAGACACCCAAACTCGAGTTTGGGTGTCTCTTCTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-902s1c1
Sequence:CCGGGATTCAAATGAGCTAAGGAAACTCGAGTTTCCTTAGCTCATTTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019098.2-772s1c1
Sequence:CCGGCCCATATCAAACCGCAGACAACTCGAGTTGTCTGCGGTTTGATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013927
CNGB3 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel beta 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013927.1-3864s1c1
Sequence:CCGGCGGAGACAATTACCAAAGTTACTCGAGTAACTTTGGTAATTGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1201s1c1
Sequence:CCGGGCTCAACTAAATGGGTCTATACTCGAGTATAGACCCATTTAGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1428s1c1
Sequence:CCGGGCCTGCATGGACCATATCATTCTCGAGAATGATATGGTCCATGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1888s1c1
Sequence:CCGGCCCACGGATTTGCCAATCTTTCTCGAGAAAGATTGGCAAATCCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-390s1c1
Sequence:CCGGCCAGTCAGCTTTAAGACCAAACTCGAGTTTGGTCTTAAAGCTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013927
CNGB3 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel beta 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013927.1-3864s1c1
Sequence:CCGGCGGAGACAATTACCAAAGTTACTCGAGTAACTTTGGTAATTGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1201s1c1
Sequence:CCGGGCTCAACTAAATGGGTCTATACTCGAGTATAGACCCATTTAGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1428s1c1
Sequence:CCGGGCCTGCATGGACCATATCATTCTCGAGAATGATATGGTCCATGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1888s1c1
Sequence:CCGGCCCACGGATTTGCCAATCTTTCTCGAGAAAGATTGGCAAATCCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-390s1c1
Sequence:CCGGCCAGTCAGCTTTAAGACCAAACTCGAGTTTGGTCTTAAAGCTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013927
CNGB3 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel beta 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013927.1-3864s1c1
Sequence:CCGGCGGAGACAATTACCAAAGTTACTCGAGTAACTTTGGTAATTGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1201s1c1
Sequence:CCGGGCTCAACTAAATGGGTCTATACTCGAGTATAGACCCATTTAGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1428s1c1
Sequence:CCGGGCCTGCATGGACCATATCATTCTCGAGAATGATATGGTCCATGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-1888s1c1
Sequence:CCGGCCCACGGATTTGCCAATCTTTCTCGAGAAAGATTGGCAAATCCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013927.1-390s1c1
Sequence:CCGGCCAGTCAGCTTTAAGACCAAACTCGAGTTTGGTCTTAAAGCTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)