EMAIL THIS PAGE TO A FRIEND

CNIH1

cornichon family AMPA receptor auxiliary protein 1

110 Gene Product Result for
Synonyms: CNIH CNIL TGAM77
Species: Human CNIH1(10175), Zebrafish cnih1(406282)
Gene ID:
Zebrafish(406282) cornichon family AMPA receptor auxiliary protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005776 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048251 MISSION® esiRNA esiRNA human CNIH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009551 Rosetta Predictions human pricing
NM_005776 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061362 predicted 684
2 SASI_Hs01_00061363 predicted 716
3 SASI_Hs01_00061364 predicted 745
4 SASI_Hs01_00061365 predicted 745
5 SASI_Hs01_00061366 predicted 478
6 SASI_Hs01_00061367 predicted 601
7 SASI_Hs01_00061368 predicted 696
8 SASI_Hs01_00061369 predicted 637
9 SASI_Hs01_00061370 predicted 208
10 SASI_Hs01_00061371 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340260 predicted 205
2 SASI_Hs01_00064871 predicted 783
3 SASI_Hs01_00064872 predicted 824
4 SASI_Hs02_00340261 predicted 199
5 SASI_Hs01_00064876 predicted 577
6 SASI_Hs02_00340262 predicted 714
7 SASI_Hs01_00064878 predicted 800
8 SASI_Hs02_00340263 predicted 311
9 SASI_Hs02_00340264 predicted 783
10 SASI_Hs02_00340265 predicted 415
11 SASI_Hs01_00064870 predicted 1007
12 SASI_Hs01_00064873 predicted 634
13 SASI_Hs01_00064874 predicted 952
14 SASI_Hs01_00064875 predicted 864
15 SASI_Hs01_00064877 predicted 990
16 SASI_Hs01_00064879 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005776
VALIDATED
CNIH1 MISSION shRNA Bacterial Glycerol Stock
cornichon family AMPA receptor auxiliary protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-170s21c1
Sequence:CCGGTTCGCCATTTGGCACATTATACTCGAGTATAATGTGCCAAATGGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-1013s21c1
Sequence:CCGGCATCTGTCATGTCGATGATTACTCGAGTAATCATCGACATGACAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-501s21c1
Sequence:CCGGACCTATATGGCATGATCTATGCTCGAGCATAGATCATGCCATATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-342s21c1
Sequence:CCGGCCCTCTTGGCATATCATATTTCTCGAGAAATATGATATGCCAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-396s21c1
Sequence:CCGGCAGGACTCTATGACCCTACAACTCGAGTTGTAGGGTCATAGAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-349s1c1
Sequence:CCGGCAGGACTCTATGACCCTACAACTCGAGTTGTAGGGTCATAGAGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005776.1-394s1c1
Sequence:CCGGCATATTGTCAGAAGGAAGGATCTCGAGATCCTTCCTTCTGACAATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-295s1c1
Sequence:CCGGCCCTCTTGGCATATCATATTTCTCGAGAAATATGATATGCCAAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-155s1c1
Sequence:CCGGGCTGAAGACTGATTACAAGAACTCGAGTTCTTGTAATCAGTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-173s1c1
Sequence:CCGGGAATCCTATAGACCAGTGTAACTCGAGTTACACTGGTCTATAGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005776.1-234s1c1
Sequence:CCGGGCTTTCTTCTGTGTCATGTTTCTCGAGAAACATGACACAGAAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-390s1c1
Sequence:CCGGCTAGCATATTGTCAGAAGGAACTCGAGTTCCTTCTGACAATATGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005776
VALIDATED
CNIH1 MISSION shRNA shRNA Plasmid DNA
cornichon family AMPA receptor auxiliary protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-170s21c1
Sequence:CCGGTTCGCCATTTGGCACATTATACTCGAGTATAATGTGCCAAATGGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-1013s21c1
Sequence:CCGGCATCTGTCATGTCGATGATTACTCGAGTAATCATCGACATGACAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-501s21c1
Sequence:CCGGACCTATATGGCATGATCTATGCTCGAGCATAGATCATGCCATATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-342s21c1
Sequence:CCGGCCCTCTTGGCATATCATATTTCTCGAGAAATATGATATGCCAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-396s21c1
Sequence:CCGGCAGGACTCTATGACCCTACAACTCGAGTTGTAGGGTCATAGAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-349s1c1
Sequence:CCGGCAGGACTCTATGACCCTACAACTCGAGTTGTAGGGTCATAGAGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005776.1-394s1c1
Sequence:CCGGCATATTGTCAGAAGGAAGGATCTCGAGATCCTTCCTTCTGACAATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-295s1c1
Sequence:CCGGCCCTCTTGGCATATCATATTTCTCGAGAAATATGATATGCCAAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-155s1c1
Sequence:CCGGGCTGAAGACTGATTACAAGAACTCGAGTTCTTGTAATCAGTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-173s1c1
Sequence:CCGGGAATCCTATAGACCAGTGTAACTCGAGTTACACTGGTCTATAGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005776.1-234s1c1
Sequence:CCGGGCTTTCTTCTGTGTCATGTTTCTCGAGAAACATGACACAGAAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-390s1c1
Sequence:CCGGCTAGCATATTGTCAGAAGGAACTCGAGTTCCTTCTGACAATATGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005776
VALIDATED
CNIH1 MISSION shRNA Lentiviral Transduction Particles
cornichon family AMPA receptor auxiliary protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-170s21c1
Sequence:CCGGTTCGCCATTTGGCACATTATACTCGAGTATAATGTGCCAAATGGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-1013s21c1
Sequence:CCGGCATCTGTCATGTCGATGATTACTCGAGTAATCATCGACATGACAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-501s21c1
Sequence:CCGGACCTATATGGCATGATCTATGCTCGAGCATAGATCATGCCATATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-342s21c1
Sequence:CCGGCCCTCTTGGCATATCATATTTCTCGAGAAATATGATATGCCAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005776.2-396s21c1
Sequence:CCGGCAGGACTCTATGACCCTACAACTCGAGTTGTAGGGTCATAGAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-349s1c1
Sequence:CCGGCAGGACTCTATGACCCTACAACTCGAGTTGTAGGGTCATAGAGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005776.1-394s1c1
Sequence:CCGGCATATTGTCAGAAGGAAGGATCTCGAGATCCTTCCTTCTGACAATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-295s1c1
Sequence:CCGGCCCTCTTGGCATATCATATTTCTCGAGAAATATGATATGCCAAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-155s1c1
Sequence:CCGGGCTGAAGACTGATTACAAGAACTCGAGTTCTTGTAATCAGTCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-173s1c1
Sequence:CCGGGAATCCTATAGACCAGTGTAACTCGAGTTACACTGGTCTATAGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005776.1-234s1c1
Sequence:CCGGGCTTTCTTCTGTGTCATGTTTCTCGAGAAACATGACACAGAAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005776.1-390s1c1
Sequence:CCGGCTAGCATATTGTCAGAAGGAACTCGAGTTCCTTCTGACAATATGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)