EMAIL THIS PAGE TO A FRIEND

CNIH2

cornichon family AMPA receptor auxiliary protein 2

85 Gene Product Result for
Synonyms: CNIH-2 Cnil
UniProtKB ID: Q6PI25
Gene ID:
Human(254263) Summary: The protein encoded by this gene is an auxiliary subunit of the ionotropic glutamate receptor of the AMPA subtype. AMPA receptors mediate fast synaptic neurotransmission in the central nervous system. This protein has been reported to interact with the Type I AMPA receptor regulatory protein isoform gamma-8 to control assembly of hippocampal AMPA receptor complexes, thereby modulating receptor gating and pharmacology. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(12794) cornichon homolog 2 (Drosophila)
Rat(361705) cornichon homolog 2 (Drosophila)
Zebrafish(541397) cornichon homolog 2 (Drosophila)
cow(618106) cornichon homolog 2 (Drosophila)
domestic cat(101099078) cornichon homolog 2 (Drosophila)
dog(100685780) cornichon homolog 2 (Drosophila)
chicken(613230) cornichon homolog 2
domestic guinea pig(100713641) cornichon homolog 2 (Drosophila)
naked mole-rat(101698634) cornichon homolog 2 (Drosophila)
sheep(101113182) cornichon homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302815 ANTI-CNIH2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182553 Rosetta Predictions human pricing
NM_001025132 Rosetta Predictions rat pricing
NM_009920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107410 predicted 626
2 SASI_Hs01_00107412 predicted 452
3 SASI_Hs01_00107413 predicted 623
4 SASI_Hs01_00107414 predicted 562
5 SASI_Hs01_00107415 predicted 452
6 SASI_Hs01_00107416 predicted 621
7 SASI_Hs01_00107418 predicted 633
8 SASI_Hs02_00370669 predicted 580
9 SASI_Hs01_00107419 predicted 564
10 SASI_Hs02_00370670 predicted 546
11 SASI_Hs01_00107411 predicted 590
12 SASI_Hs01_00107417 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100243 predicted 668
2 SASI_Rn02_00203052 predicted 1045
3 SASI_Rn01_00100244 predicted 579
4 SASI_Rn01_00100245 predicted 995
5 SASI_Rn01_00100246 predicted 655
6 SASI_Rn01_00100248 predicted 902
7 SASI_Rn01_00100249 predicted 641
8 SASI_Rn01_00100250 predicted 336
9 SASI_Rn01_00100251 predicted 741
10 SASI_Rn02_00203053 predicted 558
11 SASI_Rn01_00100242 predicted 450
12 SASI_Rn01_00100247 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058313 predicted 210
2 SASI_Mm01_00058314 predicted 348
3 SASI_Mm01_00058315 predicted 573
4 SASI_Mm01_00058316 predicted 540
5 SASI_Mm01_00058317 predicted 328
6 SASI_Mm02_00317449 predicted 949
7 SASI_Mm01_00058319 predicted 808
8 SASI_Mm02_00317450 predicted 550
9 SASI_Mm01_00058320 predicted 564
10 SASI_Mm02_00317451 predicted 949
11 SASI_Mm01_00058318 predicted 494
12 SASI_Mm01_00058321 predicted 245
13 SASI_Mm01_00058322 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182553
CNIH2 MISSION shRNA Bacterial Glycerol Stock
cornichon family AMPA receptor auxiliary protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-298s1c1
Sequence:CCGGCTTTGTCATCTGGCACATCATCTCGAGATGATGTGCCAGATGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-286s1c1
Sequence:CCGGCTCCCTCATCTTCTTTGTCATCTCGAGATGACAAAGAAGATGAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-661s1c1
Sequence:CCGGGCTCTCCTTCTTCTATTACCTCTCGAGAGGTAATAGAAGAAGGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-295s1c1
Sequence:CCGGCTTCTTTGTCATCTGGCACATCTCGAGATGTGCCAGATGACAAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-610s1c1
Sequence:CCGGCATTCTCAACTACTGCCAGAACTCGAGTTCTGGCAGTAGTTGAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182553.1-1227s1c1
Sequence:CCGGCACCTTGTCTCTTGGACCTATCTCGAGATAGGTCCAAGAGACAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-470s1c1
Sequence:CCGGCTGATGTTTCTGTGTGCAGCACTCGAGTGCTGCACACAGAAACATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182553.1-1038s1c1
Sequence:CCGGCAGAGCTTGACCCTGGAAATTCTCGAGAATTTCCAGGGTCAAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-637s1c1
Sequence:CCGGCTGGTGCAAACTTGCCTTCTACTCGAGTAGAAGGCAAGTTTGCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-577s1c1
Sequence:CCGGCATGTATGATGCGGTCTCCATCTCGAGATGGAGACCGCATCATACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182553
CNIH2 MISSION shRNA shRNA Plasmid DNA
cornichon family AMPA receptor auxiliary protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-298s1c1
Sequence:CCGGCTTTGTCATCTGGCACATCATCTCGAGATGATGTGCCAGATGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-286s1c1
Sequence:CCGGCTCCCTCATCTTCTTTGTCATCTCGAGATGACAAAGAAGATGAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-661s1c1
Sequence:CCGGGCTCTCCTTCTTCTATTACCTCTCGAGAGGTAATAGAAGAAGGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-295s1c1
Sequence:CCGGCTTCTTTGTCATCTGGCACATCTCGAGATGTGCCAGATGACAAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-610s1c1
Sequence:CCGGCATTCTCAACTACTGCCAGAACTCGAGTTCTGGCAGTAGTTGAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182553.1-1227s1c1
Sequence:CCGGCACCTTGTCTCTTGGACCTATCTCGAGATAGGTCCAAGAGACAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-470s1c1
Sequence:CCGGCTGATGTTTCTGTGTGCAGCACTCGAGTGCTGCACACAGAAACATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182553.1-1038s1c1
Sequence:CCGGCAGAGCTTGACCCTGGAAATTCTCGAGAATTTCCAGGGTCAAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-637s1c1
Sequence:CCGGCTGGTGCAAACTTGCCTTCTACTCGAGTAGAAGGCAAGTTTGCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-577s1c1
Sequence:CCGGCATGTATGATGCGGTCTCCATCTCGAGATGGAGACCGCATCATACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182553
CNIH2 MISSION shRNA Lentiviral Transduction Particles
cornichon family AMPA receptor auxiliary protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-298s1c1
Sequence:CCGGCTTTGTCATCTGGCACATCATCTCGAGATGATGTGCCAGATGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-286s1c1
Sequence:CCGGCTCCCTCATCTTCTTTGTCATCTCGAGATGACAAAGAAGATGAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-661s1c1
Sequence:CCGGGCTCTCCTTCTTCTATTACCTCTCGAGAGGTAATAGAAGAAGGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-295s1c1
Sequence:CCGGCTTCTTTGTCATCTGGCACATCTCGAGATGTGCCAGATGACAAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-610s1c1
Sequence:CCGGCATTCTCAACTACTGCCAGAACTCGAGTTCTGGCAGTAGTTGAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182553.1-1227s1c1
Sequence:CCGGCACCTTGTCTCTTGGACCTATCTCGAGATAGGTCCAAGAGACAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-470s1c1
Sequence:CCGGCTGATGTTTCTGTGTGCAGCACTCGAGTGCTGCACACAGAAACATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182553.1-1038s1c1
Sequence:CCGGCAGAGCTTGACCCTGGAAATTCTCGAGAATTTCCAGGGTCAAGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182553.1-637s1c1
Sequence:CCGGCTGGTGCAAACTTGCCTTCTACTCGAGTAGAAGGCAAGTTTGCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182553.1-577s1c1
Sequence:CCGGCATGTATGATGCGGTCTCCATCTCGAGATGGAGACCGCATCATACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009920
CNIH2 MISSION shRNA Bacterial Glycerol Stock
cornichon family AMPA receptor auxiliary protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-587s1c1
Sequence:CCGGGCTGTCCTTCTTCTATTACCTCTCGAGAGGTAATAGAAGAAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-608s1c1
Sequence:CCGGGTACAGTATGGTTTATACGTTCTCGAGAACGTATAAACCATACTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009920.1-952s1c1
Sequence:CCGGGCAGACCTTGATCCTGGAAATCTCGAGATTTCCAGGATCAAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-527s1c1
Sequence:CCGGGAATGCTGACATCCTCAACTACTCGAGTAGTTGAGGATGTCAGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-502s1c1
Sequence:CCGGTCATGTATGATGCGGTCTCTACTCGAGTAGAGACCGCATCATACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009920
CNIH2 MISSION shRNA shRNA Plasmid DNA
cornichon family AMPA receptor auxiliary protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-587s1c1
Sequence:CCGGGCTGTCCTTCTTCTATTACCTCTCGAGAGGTAATAGAAGAAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-608s1c1
Sequence:CCGGGTACAGTATGGTTTATACGTTCTCGAGAACGTATAAACCATACTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009920.1-952s1c1
Sequence:CCGGGCAGACCTTGATCCTGGAAATCTCGAGATTTCCAGGATCAAGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-527s1c1
Sequence:CCGGGAATGCTGACATCCTCAACTACTCGAGTAGTTGAGGATGTCAGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-502s1c1
Sequence:CCGGTCATGTATGATGCGGTCTCTACTCGAGTAGAGACCGCATCATACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009920
CNIH2 MISSION shRNA Lentiviral Transduction Particles
cornichon family AMPA receptor auxiliary protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-587s1c1
Sequence:CCGGGCTGTCCTTCTTCTATTACCTCTCGAGAGGTAATAGAAGAAGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-608s1c1
Sequence:CCGGGTACAGTATGGTTTATACGTTCTCGAGAACGTATAAACCATACTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009920.1-952s1c1
Sequence:CCGGGCAGACCTTGATCCTGGAAATCTCGAGATTTCCAGGATCAAGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-527s1c1
Sequence:CCGGGAATGCTGACATCCTCAACTACTCGAGTAGTTGAGGATGTCAGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009920.1-502s1c1
Sequence:CCGGTCATGTATGATGCGGTCTCTACTCGAGTAGAGACCGCATCATACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)