EMAIL THIS PAGE TO A FRIEND

CNIH3

cornichon family AMPA receptor auxiliary protein 3

82 Gene Product Result for
Synonyms: CNIH-3
UniProtKB ID: Q8TBE1
Gene ID:
Mouse(72978) cornichon homolog 3 (Drosophila)
Rat(690252) cornichon homolog 3 (Drosophila)
sheep(101110075) cornichon homolog 3 (Drosophila)
naked mole-rat(101699197) cornichon homolog 3 (Drosophila)
domestic guinea pig(100733808) cornichon homolog 3 (Drosophila)
Zebrafish(564015) cornichon homolog 3 (Drosophila)
chicken(421323) cornichon homolog 3 (Drosophila)
domestic cat(101084507) cornichon homolog 3 (Drosophila)
cow(615236) cornichon homolog 3 (Drosophila)
dog(100688604) cornichon homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152495 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136381 MISSION® esiRNA esiRNA human CNIH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152495 Rosetta Predictions human pricing
XM_001073856 Rosetta Predictions rat pricing
NM_028408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122398 predicted 966
2 SASI_Hs01_00122399 predicted 1516
3 SASI_Hs01_00122401 predicted 1102
4 SASI_Hs01_00122402 predicted 1616
5 SASI_Hs01_00122403 predicted 1457
6 SASI_Hs01_00122404 predicted 1379
7 SASI_Hs02_00366272 predicted 1000
8 SASI_Hs01_00122405 predicted 1154
9 SASI_Hs01_00122406 predicted 1341
10 SASI_Hs01_00122407 predicted 1055
11 SASI_Hs01_00122400 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344217 predicted 313
2 SASI_Rn02_00344218 predicted 320
3 SASI_Rn02_00344219 predicted 224
4 SASI_Rn02_00344220 predicted 223
5 SASI_Rn02_00344221 predicted 276
6 SASI_Rn02_00344222 predicted 307
7 SASI_Rn02_00344223 predicted 267
8 SASI_Rn02_00344224 predicted 203
9 SASI_Rn02_00344225 predicted 318
10 SASI_Rn02_00344226 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121301 predicted 1205
2 SASI_Mm01_00121302 predicted 795
3 SASI_Mm01_00121303 predicted 1309
4 SASI_Mm01_00121304 predicted 1295
5 SASI_Mm01_00121305 predicted 883
6 SASI_Mm01_00121306 predicted 1252
7 SASI_Mm01_00121307 predicted 898
8 SASI_Mm01_00121308 predicted 1411
9 SASI_Mm01_00121309 predicted 1156
10 SASI_Mm01_00121310 predicted 1435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028408
CNIH3 MISSION shRNA Bacterial Glycerol Stock
cornichon family AMPA receptor auxiliary protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028408.1-1553s1c1
Sequence:CCGGGCCAGCTTGTAGCTGATGAAACTCGAGTTTCATCAGCTACAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-891s1c1
Sequence:CCGGCGAGCTAAGAACGGATTTCAACTCGAGTTGAAATCCGTTCTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-954s1c1
Sequence:CCGGGCTGAGGAACATCGAACGCATCTCGAGATGCGTTCGATGTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-873s1c1
Sequence:CCGGGCACATAATCGCCTTTGACGACTCGAGTCGTCAAAGGCGATTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-1302s1c1
Sequence:CCGGGTACTGCATGATTTACACCTTCTCGAGAAGGTGTAAATCATGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028408
CNIH3 MISSION shRNA shRNA Plasmid DNA
cornichon family AMPA receptor auxiliary protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028408.1-1553s1c1
Sequence:CCGGGCCAGCTTGTAGCTGATGAAACTCGAGTTTCATCAGCTACAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-891s1c1
Sequence:CCGGCGAGCTAAGAACGGATTTCAACTCGAGTTGAAATCCGTTCTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-954s1c1
Sequence:CCGGGCTGAGGAACATCGAACGCATCTCGAGATGCGTTCGATGTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-873s1c1
Sequence:CCGGGCACATAATCGCCTTTGACGACTCGAGTCGTCAAAGGCGATTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-1302s1c1
Sequence:CCGGGTACTGCATGATTTACACCTTCTCGAGAAGGTGTAAATCATGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028408
CNIH3 MISSION shRNA Lentiviral Transduction Particles
cornichon family AMPA receptor auxiliary protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028408.1-1553s1c1
Sequence:CCGGGCCAGCTTGTAGCTGATGAAACTCGAGTTTCATCAGCTACAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-891s1c1
Sequence:CCGGCGAGCTAAGAACGGATTTCAACTCGAGTTGAAATCCGTTCTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-954s1c1
Sequence:CCGGGCTGAGGAACATCGAACGCATCTCGAGATGCGTTCGATGTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-873s1c1
Sequence:CCGGGCACATAATCGCCTTTGACGACTCGAGTCGTCAAAGGCGATTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028408.1-1302s1c1
Sequence:CCGGGTACTGCATGATTTACACCTTCTCGAGAAGGTGTAAATCATGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152495
CNIH3 MISSION shRNA Bacterial Glycerol Stock
cornichon family AMPA receptor auxiliary protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-1067s1c1
Sequence:CCGGGAATGCCGACACTTTGAGTTACTCGAGTAACTCAAAGTGTCGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-1071s1c1
Sequence:CCGGGCCGACACTTTGAGTTACTGTCTCGAGACAGTAACTCAAAGTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-825s1c1
Sequence:CCGGGACCAGTGCAATCCTGTTCATCTCGAGATGAACAGGATTGCACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152495.1-875s1c1
Sequence:CCGGCATCTGCTTCCTTCTGCGAAACTCGAGTTTCGCAGAAGGAAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152495.1-1655s1c1
Sequence:CCGGCCCAAGACTCTTGTTGCCTTTCTCGAGAAAGGCAACAAGAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152495.1-1073s1c1
Sequence:CCGGCGACACTTTGAGTTACTGTCACTCGAGTGACAGTAACTCAAAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152495.1-2090s1c1
Sequence:CCGGCGTGAGGACATCATCTTATTTCTCGAGAAATAAGATGATGTCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152495
CNIH3 MISSION shRNA shRNA Plasmid DNA
cornichon family AMPA receptor auxiliary protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-1067s1c1
Sequence:CCGGGAATGCCGACACTTTGAGTTACTCGAGTAACTCAAAGTGTCGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-1071s1c1
Sequence:CCGGGCCGACACTTTGAGTTACTGTCTCGAGACAGTAACTCAAAGTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-825s1c1
Sequence:CCGGGACCAGTGCAATCCTGTTCATCTCGAGATGAACAGGATTGCACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152495.1-875s1c1
Sequence:CCGGCATCTGCTTCCTTCTGCGAAACTCGAGTTTCGCAGAAGGAAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152495.1-1655s1c1
Sequence:CCGGCCCAAGACTCTTGTTGCCTTTCTCGAGAAAGGCAACAAGAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152495.1-1073s1c1
Sequence:CCGGCGACACTTTGAGTTACTGTCACTCGAGTGACAGTAACTCAAAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152495.1-2090s1c1
Sequence:CCGGCGTGAGGACATCATCTTATTTCTCGAGAAATAAGATGATGTCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152495
CNIH3 MISSION shRNA Lentiviral Transduction Particles
cornichon family AMPA receptor auxiliary protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-1067s1c1
Sequence:CCGGGAATGCCGACACTTTGAGTTACTCGAGTAACTCAAAGTGTCGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-1071s1c1
Sequence:CCGGGCCGACACTTTGAGTTACTGTCTCGAGACAGTAACTCAAAGTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152495.1-825s1c1
Sequence:CCGGGACCAGTGCAATCCTGTTCATCTCGAGATGAACAGGATTGCACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152495.1-875s1c1
Sequence:CCGGCATCTGCTTCCTTCTGCGAAACTCGAGTTTCGCAGAAGGAAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152495.1-1655s1c1
Sequence:CCGGCCCAAGACTCTTGTTGCCTTTCTCGAGAAAGGCAACAAGAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152495.1-1073s1c1
Sequence:CCGGCGACACTTTGAGTTACTGTCACTCGAGTGACAGTAACTCAAAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152495.1-2090s1c1
Sequence:CCGGCGTGAGGACATCATCTTATTTCTCGAGAAATAAGATGATGTCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks