EMAIL THIS PAGE TO A FRIEND

CNIH4

cornichon family AMPA receptor auxiliary protein 4

77 Gene Product Result for
UniProtKB ID: Q9P003, A8K1Q8, B2R553, Q9H0X8
Gene ID:
Mouse(98417) cornichon homolog 4 (Drosophila)
Rat(289324) cornichon homolog 4 (Drosophila)
Zebrafish(559388) cornichon homolog 4 (Drosophila)
chicken(421325) cornichon homolog 4 (Drosophila)
cow(508912) cornichon homolog 4 (Drosophila)
domestic cat(101084251) cornichon homolog 4 (Drosophila)
dog(480116) cornichon homolog 4 (Drosophila)
domestic guinea pig(100734277) cornichon homolog 4 (Drosophila)
naked mole-rat(101724183) cornichon homolog 4 (Drosophila)
sheep(101109287) cornichon homolog 4 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014184 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014184 Rosetta Predictions human pricing
NM_001105981 Rosetta Predictions rat pricing
NM_030131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345213 predicted 250
2 SASI_Hs01_00194623 predicted 295
3 SASI_Hs01_00194624 predicted 262
4 SASI_Hs01_00194625 predicted 312
5 SASI_Hs01_00194626 predicted 254
6 SASI_Hs01_00194627 predicted 257
7 SASI_Hs01_00194629 predicted 212
8 SASI_Hs02_00345214 predicted 253
9 SASI_Hs02_00345215 predicted 201
10 SASI_Hs01_00194630 predicted 343
11 SASI_Hs01_00194628 predicted 376
12 SASI_Hs01_00194631 predicted 202
13 SASI_Hs01_00194632 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214452 predicted 249
2 SASI_Rn02_00214453 predicted 453
3 SASI_Rn02_00214454 predicted 951
4 SASI_Rn02_00214455 predicted 989
5 SASI_Rn02_00214456 predicted 445
6 SASI_Rn02_00214457 predicted 988
7 SASI_Rn02_00214458 predicted 411
8 SASI_Rn02_00214459 predicted 985
9 SASI_Rn02_00214460 predicted 319
10 SASI_Rn02_00214461 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336521 predicted 376
2 SASI_Mm01_00068438 predicted 369
3 SASI_Mm02_00336522 predicted 138
4 SASI_Mm02_00336523 predicted 451
5 SASI_Mm02_00336524 predicted 137
6 SASI_Mm02_00336525 predicted 416
7 SASI_Mm02_00336526 predicted 438
8 SASI_Mm02_00336527 predicted 139
9 SASI_Mm02_00336528 predicted 340
10 SASI_Mm02_00336529 predicted 298
11 SASI_Mm01_00068435 predicted 230
12 SASI_Mm01_00068436 predicted 235
13 SASI_Mm01_00068437 predicted 244
14 SASI_Mm01_00068439 predicted 241
15 SASI_Mm01_00068440 predicted 281
16 SASI_Mm01_00068441 predicted 230
17 SASI_Mm01_00068442 predicted 288
18 SASI_Mm01_00068443 predicted 316
19 SASI_Mm01_00068444 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014184
CNIH4 MISSION shRNA Bacterial Glycerol Stock
cornichon family AMPA receptor auxiliary protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-357s1c1
Sequence:CCGGGTCACACATGAAAGAAGCCATCTCGAGATGGCTTCTTTCATGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-300s1c1
Sequence:CCGGGAGTGGTAACATGGGAGTGTTCTCGAGAACACTCCCATGTTACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-87s1c1
Sequence:CCGGCCTCTCGGTCTACTTCATAATCTCGAGATTATGAAGTAGACCGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-322s1c1
Sequence:CCGGGATCCAACAGAAATACACAATCTCGAGATTGTGTATTTCTGTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014184.1-502s1c1
Sequence:CCGGGAGGAGCCAGAGACTTCTTAACTCGAGTTAAGAAGTCTCTGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-299s21c1
Sequence:CCGGGAGTGGTAACATGGGAGTGTTCTCGAGAACACTCCCATGTTACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-356s21c1
Sequence:CCGGGTCACACATGAAAGAAGCCATCTCGAGATGGCTTCTTTCATGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-321s21c1
Sequence:CCGGGATCCAACAGAAATACACAATCTCGAGATTGTGTATTTCTGTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-86s21c1
Sequence:CCGGCCTCTCGGTCTACTTCATAATCTCGAGATTATGAAGTAGACCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014184
CNIH4 MISSION shRNA shRNA Plasmid DNA
cornichon family AMPA receptor auxiliary protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-357s1c1
Sequence:CCGGGTCACACATGAAAGAAGCCATCTCGAGATGGCTTCTTTCATGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-300s1c1
Sequence:CCGGGAGTGGTAACATGGGAGTGTTCTCGAGAACACTCCCATGTTACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-87s1c1
Sequence:CCGGCCTCTCGGTCTACTTCATAATCTCGAGATTATGAAGTAGACCGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-322s1c1
Sequence:CCGGGATCCAACAGAAATACACAATCTCGAGATTGTGTATTTCTGTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014184.1-502s1c1
Sequence:CCGGGAGGAGCCAGAGACTTCTTAACTCGAGTTAAGAAGTCTCTGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-299s21c1
Sequence:CCGGGAGTGGTAACATGGGAGTGTTCTCGAGAACACTCCCATGTTACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-356s21c1
Sequence:CCGGGTCACACATGAAAGAAGCCATCTCGAGATGGCTTCTTTCATGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-321s21c1
Sequence:CCGGGATCCAACAGAAATACACAATCTCGAGATTGTGTATTTCTGTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-86s21c1
Sequence:CCGGCCTCTCGGTCTACTTCATAATCTCGAGATTATGAAGTAGACCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014184
CNIH4 MISSION shRNA Lentiviral Transduction Particles
cornichon family AMPA receptor auxiliary protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-357s1c1
Sequence:CCGGGTCACACATGAAAGAAGCCATCTCGAGATGGCTTCTTTCATGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-300s1c1
Sequence:CCGGGAGTGGTAACATGGGAGTGTTCTCGAGAACACTCCCATGTTACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-87s1c1
Sequence:CCGGCCTCTCGGTCTACTTCATAATCTCGAGATTATGAAGTAGACCGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014184.1-322s1c1
Sequence:CCGGGATCCAACAGAAATACACAATCTCGAGATTGTGTATTTCTGTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014184.1-502s1c1
Sequence:CCGGGAGGAGCCAGAGACTTCTTAACTCGAGTTAAGAAGTCTCTGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-299s21c1
Sequence:CCGGGAGTGGTAACATGGGAGTGTTCTCGAGAACACTCCCATGTTACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-356s21c1
Sequence:CCGGGTCACACATGAAAGAAGCCATCTCGAGATGGCTTCTTTCATGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-321s21c1
Sequence:CCGGGATCCAACAGAAATACACAATCTCGAGATTGTGTATTTCTGTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014184.2-86s21c1
Sequence:CCGGCCTCTCGGTCTACTTCATAATCTCGAGATTATGAAGTAGACCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030131
VALIDATED
CNIH4 MISSION shRNA Bacterial Glycerol Stock
cornichon family AMPA receptor auxiliary protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-453s1c1
Sequence:CCGGGCTATACTACACACTGCACAACTCGAGTTGTGCAGTGTGTAGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-66s1c1
Sequence:CCGGCGTCTACTTCATCATTACATTCTCGAGAATGTAATGATGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-72s1c1
Sequence:CCGGCTTCATCATTACATTGTCTGACTCGAGTCAGACAATGTAATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-485s1c1
Sequence:CCGGGAAACTACTAAACCACCCTTACTCGAGTAAGGGTGGTTTAGTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-103s1c1
Sequence:CCGGGATTACATTAACGCCAGATCACTCGAGTGATCTGGCGTTAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030131
VALIDATED
CNIH4 MISSION shRNA shRNA Plasmid DNA
cornichon family AMPA receptor auxiliary protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-453s1c1
Sequence:CCGGGCTATACTACACACTGCACAACTCGAGTTGTGCAGTGTGTAGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-66s1c1
Sequence:CCGGCGTCTACTTCATCATTACATTCTCGAGAATGTAATGATGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-72s1c1
Sequence:CCGGCTTCATCATTACATTGTCTGACTCGAGTCAGACAATGTAATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-485s1c1
Sequence:CCGGGAAACTACTAAACCACCCTTACTCGAGTAAGGGTGGTTTAGTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-103s1c1
Sequence:CCGGGATTACATTAACGCCAGATCACTCGAGTGATCTGGCGTTAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030131
VALIDATED
CNIH4 MISSION shRNA Lentiviral Transduction Particles
cornichon family AMPA receptor auxiliary protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-453s1c1
Sequence:CCGGGCTATACTACACACTGCACAACTCGAGTTGTGCAGTGTGTAGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-66s1c1
Sequence:CCGGCGTCTACTTCATCATTACATTCTCGAGAATGTAATGATGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-72s1c1
Sequence:CCGGCTTCATCATTACATTGTCTGACTCGAGTCAGACAATGTAATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-485s1c1
Sequence:CCGGGAAACTACTAAACCACCCTTACTCGAGTAAGGGTGGTTTAGTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030131.2-103s1c1
Sequence:CCGGGATTACATTAACGCCAGATCACTCGAGTGATCTGGCGTTAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks