EMAIL THIS PAGE TO A FRIEND

CNKSR1

connector enhancer of kinase suppressor of Ras 1

67 Gene Product Result for
Synonyms: CNK CNK1 KSR
UniProtKB ID: Q969H4, B1AMW9, O95381
Gene ID:
Human(10256) Summary: This gene is a necessary element in receptor tyrosine kinase pathways, possibly as a tyrosine phosphorylation target. It is involved in regulation of RAF in the MAPK pathway and may also play a role in a MAPK-independent pathway. [provided by RefSeq, Jul 2008]
Mouse(194231) connector enhancer of kinase suppressor of Ras 1
Rat(298545) connector enhancer of kinase suppressor of Ras 1
Zebrafish(402957) connector enhancer of kinase suppressor of Ras 1
domestic cat(101084724) connector enhancer of kinase suppressor of Ras 1
Horse(100071178) connector enhancer of kinase suppressor of Ras 1
dog(487359) connector enhancer of kinase suppressor of Ras 1
chicken(419548) connector enhancer of kinase suppressor of Ras 1
sheep(101112380) connector enhancer of kinase suppressor of Ras 1
naked mole-rat(101707837) connector enhancer of kinase suppressor of Ras 1
domestic guinea pig(100716267) connector enhancer of kinase suppressor of Ras 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_110525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006314 Rosetta Predictions human pricing
NR_023345 Rosetta Predictions human pricing
NM_001039011 Rosetta Predictions rat pricing
NM_001081047 Rosetta Predictions mouse pricing
XM_110525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108388 predicted 453
2 SASI_Hs01_00108389 predicted 1524
3 SASI_Hs01_00108390 predicted 821
4 SASI_Hs01_00108391 predicted 1377
5 SASI_Hs01_00108392 predicted 695
6 SASI_Hs01_00108393 predicted 666
7 SASI_Hs01_00108396 predicted 1484
8 SASI_Hs01_00108397 predicted 1316
9 SASI_Hs02_00341337 predicted 1456
10 SASI_Hs02_00341338 predicted 2283
11 SASI_Hs01_00108394 predicted 259
12 SASI_Hs01_00108395 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381702 predicted 440
2 SASI_Hs02_00381703 predicted 1502
3 SASI_Hs02_00381704 predicted 801
4 SASI_Hs02_00381705 predicted 1363
5 SASI_Hs02_00381706 predicted 674
6 SASI_Hs02_00381707 predicted 648
7 SASI_Hs02_00381708 predicted 1458
8 SASI_Hs02_00381709 predicted 1294
9 SASI_Hs02_00381710 predicted 1435
10 SASI_Hs02_00381711 predicted 2261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117498 predicted 1332
2 SASI_Rn01_00117499 predicted 2213
3 SASI_Rn01_00117500 predicted 1202
4 SASI_Rn01_00117501 predicted 1472
5 SASI_Rn01_00117502 predicted 1665
6 SASI_Rn01_00117503 predicted 1767
7 SASI_Rn01_00117504 predicted 734
8 SASI_Rn01_00117505 predicted 229
9 SASI_Rn01_00117506 predicted 1858
10 SASI_Rn01_00117507 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294651 predicted 1526
2 SASI_Mm02_00294652 predicted 1250
3 SASI_Mm02_00294653 predicted 588
4 SASI_Mm02_00294654 predicted 1322
5 SASI_Mm02_00294655 predicted 1835
6 SASI_Mm02_00294656 predicted 1268
7 SASI_Mm02_00294657 predicted 1183
8 SASI_Mm02_00294658 predicted 1460
9 SASI_Mm02_00294659 predicted 1398
10 SASI_Mm02_00294660 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_110525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242016 predicted 1533
2 SASI_Mm01_00242017 predicted 1253
3 SASI_Mm01_00242018 predicted 594
4 SASI_Mm01_00242019 predicted 1321
5 SASI_Mm01_00242020 predicted 1272
6 SASI_Mm01_00242021 predicted 1188
7 SASI_Mm01_00242022 predicted 1471
8 SASI_Mm01_00242023 predicted 1407
9 SASI_Mm01_00242024 predicted 1349
10 SASI_Mm01_00242025 predicted 1719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006314
CNKSR1 MISSION shRNA Bacterial Glycerol Stock
connector enhancer of kinase suppressor of Ras 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006314.2-1165s21c1
Sequence:CCGGGAGTCCTGTTGGTCGGAAGAACTCGAGTTCTTCCGACCAACAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006314.2-329s21c1
Sequence:CCGGCATGACTTCCAGAGCATAGTCCTCGAGGACTATGCTCTGGAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006314.2-2303s21c1
Sequence:CCGGGGAAGTAGTACTGCTAGTCATCTCGAGATGACTAGCAGTACTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1497s1c1
Sequence:CCGGGCGTCATCTCATTACCTGCATCTCGAGATGCAGGTAATGAGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1362s1c1
Sequence:CCGGCCTCATCAATGTCTCCAACTACTCGAGTAGTTGGAGACATTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-802s1c1
Sequence:CCGGCGTAAGAACATGGTGAGGGAACTCGAGTTCCCTCACCATGTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1451s1c1
Sequence:CCGGCCTTCATCTTCGCTGCTGATACTCGAGTATCAGCAGCGAAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-435s1c1
Sequence:CCGGCTTCTCCCACTTAAATGATTTCTCGAGAAATCATTTAAGTGGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006314
CNKSR1 MISSION shRNA shRNA Plasmid DNA
connector enhancer of kinase suppressor of Ras 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006314.2-1165s21c1
Sequence:CCGGGAGTCCTGTTGGTCGGAAGAACTCGAGTTCTTCCGACCAACAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006314.2-329s21c1
Sequence:CCGGCATGACTTCCAGAGCATAGTCCTCGAGGACTATGCTCTGGAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006314.2-2303s21c1
Sequence:CCGGGGAAGTAGTACTGCTAGTCATCTCGAGATGACTAGCAGTACTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1497s1c1
Sequence:CCGGGCGTCATCTCATTACCTGCATCTCGAGATGCAGGTAATGAGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1362s1c1
Sequence:CCGGCCTCATCAATGTCTCCAACTACTCGAGTAGTTGGAGACATTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-802s1c1
Sequence:CCGGCGTAAGAACATGGTGAGGGAACTCGAGTTCCCTCACCATGTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1451s1c1
Sequence:CCGGCCTTCATCTTCGCTGCTGATACTCGAGTATCAGCAGCGAAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-435s1c1
Sequence:CCGGCTTCTCCCACTTAAATGATTTCTCGAGAAATCATTTAAGTGGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006314
CNKSR1 MISSION shRNA Lentiviral Transduction Particles
connector enhancer of kinase suppressor of Ras 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006314.2-1165s21c1
Sequence:CCGGGAGTCCTGTTGGTCGGAAGAACTCGAGTTCTTCCGACCAACAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006314.2-329s21c1
Sequence:CCGGCATGACTTCCAGAGCATAGTCCTCGAGGACTATGCTCTGGAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006314.2-2303s21c1
Sequence:CCGGGGAAGTAGTACTGCTAGTCATCTCGAGATGACTAGCAGTACTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1497s1c1
Sequence:CCGGGCGTCATCTCATTACCTGCATCTCGAGATGCAGGTAATGAGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1362s1c1
Sequence:CCGGCCTCATCAATGTCTCCAACTACTCGAGTAGTTGGAGACATTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-802s1c1
Sequence:CCGGCGTAAGAACATGGTGAGGGAACTCGAGTTCCCTCACCATGTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-1451s1c1
Sequence:CCGGCCTTCATCTTCGCTGCTGATACTCGAGTATCAGCAGCGAAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006314.1-435s1c1
Sequence:CCGGCTTCTCCCACTTAAATGATTTCTCGAGAAATCATTTAAGTGGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081047
CNKSR1 MISSION shRNA Bacterial Glycerol Stock
connector enhancer of kinase suppressor of Ras 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000362955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081047.1-2217s21c1
Sequence:CCGGTCCCAGTCTCTGACGTGTTTACTCGAGTAAACACGTCAGAGACTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081047.1-1334s21c1
Sequence:CCGGCTCAAGGGACACACCCTATACCTCGAGGTATAGGGTGTGTCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081047.1-485s21c1
Sequence:CCGGTACCTCTTCTCTCACTTAAATCTCGAGATTTAAGTGAGAGAAGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081047
CNKSR1 MISSION shRNA shRNA Plasmid DNA
connector enhancer of kinase suppressor of Ras 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000362955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081047.1-2217s21c1
Sequence:CCGGTCCCAGTCTCTGACGTGTTTACTCGAGTAAACACGTCAGAGACTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081047.1-1334s21c1
Sequence:CCGGCTCAAGGGACACACCCTATACCTCGAGGTATAGGGTGTGTCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081047.1-485s21c1
Sequence:CCGGTACCTCTTCTCTCACTTAAATCTCGAGATTTAAGTGAGAGAAGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081047
CNKSR1 MISSION shRNA Lentiviral Transduction Particles
connector enhancer of kinase suppressor of Ras 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000362955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081047.1-2217s21c1
Sequence:CCGGTCCCAGTCTCTGACGTGTTTACTCGAGTAAACACGTCAGAGACTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081047.1-1334s21c1
Sequence:CCGGCTCAAGGGACACACCCTATACCTCGAGGTATAGGGTGTGTCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081047.1-485s21c1
Sequence:CCGGTACCTCTTCTCTCACTTAAATCTCGAGATTTAAGTGAGAGAAGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110525
CNKSR1 MISSION shRNA Bacterial Glycerol Stock
connector enhancer of kinase suppressor of Ras 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_110525.5-2071s1c1
Sequence:CCGGCCCAGTCTCTGACGTGTTTAACTCGAGTTAAACACGTCAGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1110s1c1
Sequence:CCGGCAGGCGTACTTCCAGAAGAAACTCGAGTTTCTTCTGGAAGTACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1184s1c1
Sequence:CCGGCGGAAGAAATCTAAAGGTATACTCGAGTATACCTTTAGATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-590s1c1
Sequence:CCGGGAACGAAACATCCTAAGGATTCTCGAGAATCCTTAGGATGTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1680s1c1
Sequence:CCGGCCCATGAACAATGGCGGAGTTCTCGAGAACTCCGCCATTGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110525
CNKSR1 MISSION shRNA shRNA Plasmid DNA
connector enhancer of kinase suppressor of Ras 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_110525.5-2071s1c1
Sequence:CCGGCCCAGTCTCTGACGTGTTTAACTCGAGTTAAACACGTCAGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1110s1c1
Sequence:CCGGCAGGCGTACTTCCAGAAGAAACTCGAGTTTCTTCTGGAAGTACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1184s1c1
Sequence:CCGGCGGAAGAAATCTAAAGGTATACTCGAGTATACCTTTAGATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-590s1c1
Sequence:CCGGGAACGAAACATCCTAAGGATTCTCGAGAATCCTTAGGATGTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1680s1c1
Sequence:CCGGCCCATGAACAATGGCGGAGTTCTCGAGAACTCCGCCATTGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110525
CNKSR1 MISSION shRNA Lentiviral Transduction Particles
connector enhancer of kinase suppressor of Ras 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_110525.5-2071s1c1
Sequence:CCGGCCCAGTCTCTGACGTGTTTAACTCGAGTTAAACACGTCAGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1110s1c1
Sequence:CCGGCAGGCGTACTTCCAGAAGAAACTCGAGTTTCTTCTGGAAGTACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1184s1c1
Sequence:CCGGCGGAAGAAATCTAAAGGTATACTCGAGTATACCTTTAGATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-590s1c1
Sequence:CCGGGAACGAAACATCCTAAGGATTCTCGAGAATCCTTAGGATGTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110525.5-1680s1c1
Sequence:CCGGCCCATGAACAATGGCGGAGTTCTCGAGAACTCCGCCATTGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks