EMAIL THIS PAGE TO A FRIEND

CNKSR2

connector enhancer of kinase suppressor of Ras 2

138 Gene Product Result for
Synonyms: CNK2 KSR2 MAGUIN
Gene ID:
Human(22866) Summary: This gene encodes a multidomain protein that functions as a scaffold protein to mediate the mitogen-activated protein kinase pathways downstream from Ras. This gene product is induced by vitamin D and inhibits apoptosis in certain cancer cells. It may also play a role in ternary complex assembly of synaptic proteins at the postsynaptic membrane and coupling of signal transduction to membrane/cytoskeletal remodeling. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(245684) connector enhancer of kinase suppressor of Ras 2
Rat(59322) connector enhancer of kinase suppressor of Ras 2
domestic guinea pig(100721503) connector enhancer of kinase suppressor of Ras 2
naked mole-rat(101724877) connector enhancer of kinase suppressor of Ras 2
sheep(101106407) connector enhancer of kinase suppressor of Ras 2
Domestic Rabbit(100339182) connector enhancer of kinase suppressor of Ras 2
chicken(427997) connector enhancer of kinase suppressor of Ras 2
cow(534112) connector enhancer of kinase suppressor of Ras 2
dog(480860) connector enhancer of kinase suppressor of Ras 2
domestic cat(101083322) connector enhancer of kinase suppressor of Ras 2
Horse(100059301) connector enhancer of kinase suppressor of Ras 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500904 Anti-CNKR2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
HPA001502 Anti-CNKSR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014927 Rosetta Predictions human pricing
NM_001113366 Rosetta Predictions rat pricing
NM_021686 Rosetta Predictions rat pricing
NM_177751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109295 predicted 1235
2 SASI_Hs02_00346585 predicted 2335
3 SASI_Hs01_00109298 predicted 1336
4 SASI_Hs02_00346586 predicted 2929
5 SASI_Hs01_00109299 predicted 2998
6 SASI_Hs01_00109300 predicted 1400
7 SASI_Hs01_00109301 predicted 2975
8 SASI_Hs01_00109302 predicted 731
9 SASI_Hs02_00346587 predicted 3048
10 SASI_Hs01_00109303 predicted 809
11 SASI_Hs01_00109296 predicted 2271
12 SASI_Hs01_00109297 predicted 1433
13 SASI_Hs01_00109304 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251763 predicted 637
2 SASI_Rn02_00251764 predicted 1762
3 SASI_Rn02_00251765 predicted 1482
4 SASI_Rn02_00251766 predicted 1472
5 SASI_Rn02_00251767 predicted 238
6 SASI_Rn02_00251768 predicted 1244
7 SASI_Rn02_00251769 predicted 1534
8 SASI_Rn02_00251770 predicted 625
9 SASI_Rn02_00251771 predicted 1440
10 SASI_Rn02_00251772 predicted 2402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112031 predicted 632
2 SASI_Rn02_00262710 predicted 1758
3 SASI_Rn01_00112032 predicted 1483
4 SASI_Rn01_00112033 predicted 1475
5 SASI_Rn01_00112034 predicted 243
6 SASI_Rn01_00112035 predicted 1246
7 SASI_Rn02_00262711 predicted 1537
8 SASI_Rn01_00112036 predicted 619
9 SASI_Rn01_00112038 predicted 1434
10 SASI_Rn01_00112039 predicted 2400
11 SASI_Rn01_00112037 predicted 1865
12 SASI_Rn01_00112040 predicted 2261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117835 predicted 2067
2 SASI_Mm01_00117836 predicted 1567
3 SASI_Mm01_00117837 predicted 1633
4 SASI_Mm01_00117838 predicted 2233
5 SASI_Mm01_00117839 predicted 718
6 SASI_Mm01_00117840 predicted 2301
7 SASI_Mm01_00117841 predicted 3187
8 SASI_Mm01_00117842 predicted 730
9 SASI_Mm01_00117843 predicted 265
10 SASI_Mm02_00348130 predicted 932
11 SASI_Mm01_00117834 predicted 1865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014927
VALIDATED
CNKSR2 MISSION shRNA Bacterial Glycerol Stock
connector enhancer of kinase suppressor of Ras 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014927.2-812s1c1
Sequence:CCGGGCGATGAAGTGATTCAAGTTACTCGAGTAACTTGAATCACTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-2359s1c1
Sequence:CCGGCCACTGACAAGTTCAGGCTTACTCGAGTAAGCCTGAACTTGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-691s1c1
Sequence:CCGGGCAAACATTAAACCAAGCGAACTCGAGTTCGCTTGGTTTAATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-1183s1c1
Sequence:CCGGCCAGTGCATAAGGGATCTGAACTCGAGTTCAGATCCCTTATGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-117s1c1
Sequence:CCGGGCAGCAGTATATTAAGAACTTCTCGAGAAGTTCTTAATATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3277s21c1
Sequence:CCGGATGGAATACAAGCTATCATTTCTCGAGAAATGATAGCTTGTATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3382s21c1
Sequence:CCGGGAAGTAGCCATTATCGATAAACTCGAGTTTATCGATAATGGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3248s21c1
Sequence:CCGGCACTAGGAGAACATCGTATTTCTCGAGAAATACGATGTTCTCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014927
VALIDATED
CNKSR2 MISSION shRNA shRNA Plasmid DNA
connector enhancer of kinase suppressor of Ras 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014927.2-812s1c1
Sequence:CCGGGCGATGAAGTGATTCAAGTTACTCGAGTAACTTGAATCACTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-2359s1c1
Sequence:CCGGCCACTGACAAGTTCAGGCTTACTCGAGTAAGCCTGAACTTGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-691s1c1
Sequence:CCGGGCAAACATTAAACCAAGCGAACTCGAGTTCGCTTGGTTTAATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-1183s1c1
Sequence:CCGGCCAGTGCATAAGGGATCTGAACTCGAGTTCAGATCCCTTATGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-117s1c1
Sequence:CCGGGCAGCAGTATATTAAGAACTTCTCGAGAAGTTCTTAATATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3277s21c1
Sequence:CCGGATGGAATACAAGCTATCATTTCTCGAGAAATGATAGCTTGTATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3382s21c1
Sequence:CCGGGAAGTAGCCATTATCGATAAACTCGAGTTTATCGATAATGGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3248s21c1
Sequence:CCGGCACTAGGAGAACATCGTATTTCTCGAGAAATACGATGTTCTCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014927
VALIDATED
CNKSR2 MISSION shRNA Lentiviral Transduction Particles
connector enhancer of kinase suppressor of Ras 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014927.2-812s1c1
Sequence:CCGGGCGATGAAGTGATTCAAGTTACTCGAGTAACTTGAATCACTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-2359s1c1
Sequence:CCGGCCACTGACAAGTTCAGGCTTACTCGAGTAAGCCTGAACTTGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-691s1c1
Sequence:CCGGGCAAACATTAAACCAAGCGAACTCGAGTTCGCTTGGTTTAATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-1183s1c1
Sequence:CCGGCCAGTGCATAAGGGATCTGAACTCGAGTTCAGATCCCTTATGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014927.2-117s1c1
Sequence:CCGGGCAGCAGTATATTAAGAACTTCTCGAGAAGTTCTTAATATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3277s21c1
Sequence:CCGGATGGAATACAAGCTATCATTTCTCGAGAAATGATAGCTTGTATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3382s21c1
Sequence:CCGGGAAGTAGCCATTATCGATAAACTCGAGTTTATCGATAATGGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014927.3-3248s21c1
Sequence:CCGGCACTAGGAGAACATCGTATTTCTCGAGAAATACGATGTTCTCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177751
CNKSR2 MISSION shRNA Bacterial Glycerol Stock
connector enhancer of kinase suppressor of Ras 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-3289s1c1
Sequence:CCGGCCACTAAGTATCTCTTCTGAACTCGAGTTCAGAAGAGATACTTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-783s1c1
Sequence:CCGGGCAACAGGATTGCACTGTATACTCGAGTATACAGTGCAATCCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-1585s1c1
Sequence:CCGGCCTATATCTATGCCAGTGGAACTCGAGTTCCACTGGCATAGATATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-3172s1c1
Sequence:CCGGGCCATTATTGATAAAGTCCTACTCGAGTAGGACTTTATCAATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-2071s1c1
Sequence:CCGGGCATCCCTATACTGGTATATTCTCGAGAATATACCAGTATAGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177751.2-1461s21c1
Sequence:CCGGAGAATATCGAAAGAGGTTTAACTCGAGTTAAACCTCTTTCGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177751.2-1335s21c1
Sequence:CCGGTCCTCCTGCAGAACCATATATCTCGAGATATATGGTTCTGCAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177751.2-3723s21c1
Sequence:CCGGATGAAACTTCAACCGTAAATCCTCGAGGATTTACGGTTGAAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177751
CNKSR2 MISSION shRNA shRNA Plasmid DNA
connector enhancer of kinase suppressor of Ras 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-3289s1c1
Sequence:CCGGCCACTAAGTATCTCTTCTGAACTCGAGTTCAGAAGAGATACTTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-783s1c1
Sequence:CCGGGCAACAGGATTGCACTGTATACTCGAGTATACAGTGCAATCCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-1585s1c1
Sequence:CCGGCCTATATCTATGCCAGTGGAACTCGAGTTCCACTGGCATAGATATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-3172s1c1
Sequence:CCGGGCCATTATTGATAAAGTCCTACTCGAGTAGGACTTTATCAATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-2071s1c1
Sequence:CCGGGCATCCCTATACTGGTATATTCTCGAGAATATACCAGTATAGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177751.2-1461s21c1
Sequence:CCGGAGAATATCGAAAGAGGTTTAACTCGAGTTAAACCTCTTTCGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177751.2-1335s21c1
Sequence:CCGGTCCTCCTGCAGAACCATATATCTCGAGATATATGGTTCTGCAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177751.2-3723s21c1
Sequence:CCGGATGAAACTTCAACCGTAAATCCTCGAGGATTTACGGTTGAAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177751
CNKSR2 MISSION shRNA Lentiviral Transduction Particles
connector enhancer of kinase suppressor of Ras 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-3289s1c1
Sequence:CCGGCCACTAAGTATCTCTTCTGAACTCGAGTTCAGAAGAGATACTTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-783s1c1
Sequence:CCGGGCAACAGGATTGCACTGTATACTCGAGTATACAGTGCAATCCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-1585s1c1
Sequence:CCGGCCTATATCTATGCCAGTGGAACTCGAGTTCCACTGGCATAGATATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-3172s1c1
Sequence:CCGGGCCATTATTGATAAAGTCCTACTCGAGTAGGACTTTATCAATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177751.2-2071s1c1
Sequence:CCGGGCATCCCTATACTGGTATATTCTCGAGAATATACCAGTATAGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177751.2-1461s21c1
Sequence:CCGGAGAATATCGAAAGAGGTTTAACTCGAGTTAAACCTCTTTCGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177751.2-1335s21c1
Sequence:CCGGTCCTCCTGCAGAACCATATATCTCGAGATATATGGTTCTGCAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177751.2-3723s21c1
Sequence:CCGGATGAAACTTCAACCGTAAATCCTCGAGGATTTACGGTTGAAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks