EMAIL THIS PAGE TO A FRIEND

CNKSR3

CNKSR family member 3

290 Gene Product Result for
Synonyms: MAGI1
UniProtKB ID: Q6P9H4, Q5SGD5, Q96N65
Gene ID:
Mouse(215748) Cnksr family member 3
Rat(308113) Cnksr family member 3
chicken(421646) CNKSR family member 3
cow(506781) CNKSR family member 3
Horse(100049816) CNKSR family member 3
dog(484042) CNKSR family member 3
sheep(101105165) CNKSR family member 3
Domestic Rabbit(100339815) CNKSR family member 3
Domestic Rabbit(100351011) CNKSR family member 3
naked mole-rat(101710726) CNKSR family member 3
domestic guinea pig(100713190) CNKSR family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027581 MISSION® esiRNA esiRNA human MAGI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173515 Rosetta Predictions human pricing
NM_001012061 Rosetta Predictions rat pricing
XM_574305 Rosetta Predictions rat pricing
NM_172546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070783 predicted 1352
2 SASI_Hs01_00070784 predicted 2239
3 SASI_Hs01_00070785 predicted 1251
4 SASI_Hs01_00070786 predicted 1209
5 SASI_Hs01_00070788 predicted 1333
6 SASI_Hs01_00070789 predicted 728
7 SASI_Hs01_00070791 predicted 715
8 SASI_Hs01_00070792 predicted 2145
9 SASI_Hs02_00368292 predicted 2139
10 SASI_Hs02_00368293 predicted 1614
11 SASI_Hs01_00070787 predicted 780
12 SASI_Hs01_00070790 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065944 predicted 867
2 SASI_Rn01_00065945 predicted 1600
3 SASI_Rn01_00065946 predicted 1743
4 SASI_Rn01_00065947 predicted 2029
5 SASI_Rn01_00065948 predicted 1615
6 SASI_Rn01_00065949 predicted 1034
7 SASI_Rn01_00065950 predicted 1920
8 SASI_Rn01_00065951 predicted 786
9 SASI_Rn01_00065952 predicted 1141
10 SASI_Rn01_00065953 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123932 predicted 875
2 SASI_Rn01_00123933 predicted 1607
3 SASI_Rn01_00123934 predicted 1757
4 SASI_Rn01_00123935 predicted 2036
5 SASI_Rn01_00123936 predicted 1624
6 SASI_Rn01_00123937 predicted 1041
7 SASI_Rn01_00123938 predicted 1927
8 SASI_Rn01_00123939 predicted 794
9 SASI_Rn01_00123940 predicted 1152
10 SASI_Rn01_00123941 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025598 predicted 1134
2 SASI_Mm01_00025600 predicted 1734
3 SASI_Mm01_00025602 predicted 760
4 SASI_Mm01_00025603 predicted 991
5 SASI_Mm02_00344158 predicted 820
6 SASI_Mm01_00025604 predicted 1055
7 SASI_Mm01_00025605 predicted 1990
8 SASI_Mm01_00025606 predicted 791
9 SASI_Mm02_00344159 predicted 1177
10 SASI_Mm01_00025607 predicted 1771
11 SASI_Mm01_00025599 predicted 787
12 SASI_Mm01_00025601 predicted 1077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173515
VALIDATED
CNKSR3 MISSION shRNA Bacterial Glycerol Stock
CNKSR family member 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1676s21c1
Sequence:CCGGGAAAGCCGGAGACGAAGATTCCTCGAGGAATCTTCGTCTCCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1197s21c1
Sequence:CCGGATGATGGGTTACACGTGATTACTCGAGTAATCACGTGTAACCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1023s21c1
Sequence:CCGGTAGCGGAAATGGAGGATAAAGCTCGAGCTTTATCCTCCATTTCCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1270s21c1
Sequence:CCGGTGACGAAGTCATTCAAGTTAACTCGAGTTAACTTGAATGACTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173515.2-2260s21c1
Sequence:CCGGGTATTATGTAGGGACCTTATGCTCGAGCATAAGGTCCCTACATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1880s21c1
Sequence:CCGGGATGCCCTTTGCCGGTATTTCCTCGAGGAAATACCGGCAAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1908s21c1
Sequence:CCGGAGCGGATTCCTCCGATCATTGCTCGAGCAATGATCGGAGGAATCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173515.1-757s1c1
Sequence:CCGGCACTGAATTATGGCCTCGAAACTCGAGTTTCGAGGCCATAATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-1563s1c1
Sequence:CCGGGCCATCCTGGATCTTTATATTCTCGAGAATATAAAGATCCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-1394s1c1
Sequence:CCGGCGGAGTTGTGTTACTGCTTAACTCGAGTTAAGCAGTAACACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-2055s1c1
Sequence:CCGGAGGTGCTACATCAACTCAGATCTCGAGATCTGAGTTGATGTAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-611s1c1
Sequence:CCGGCCTGCAACAATATGTCCACAACTCGAGTTGTGGACATATTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173515
VALIDATED
CNKSR3 MISSION shRNA shRNA Plasmid DNA
CNKSR family member 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1676s21c1
Sequence:CCGGGAAAGCCGGAGACGAAGATTCCTCGAGGAATCTTCGTCTCCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1197s21c1
Sequence:CCGGATGATGGGTTACACGTGATTACTCGAGTAATCACGTGTAACCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1023s21c1
Sequence:CCGGTAGCGGAAATGGAGGATAAAGCTCGAGCTTTATCCTCCATTTCCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1270s21c1
Sequence:CCGGTGACGAAGTCATTCAAGTTAACTCGAGTTAACTTGAATGACTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173515.2-2260s21c1
Sequence:CCGGGTATTATGTAGGGACCTTATGCTCGAGCATAAGGTCCCTACATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1880s21c1
Sequence:CCGGGATGCCCTTTGCCGGTATTTCCTCGAGGAAATACCGGCAAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1908s21c1
Sequence:CCGGAGCGGATTCCTCCGATCATTGCTCGAGCAATGATCGGAGGAATCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173515.1-757s1c1
Sequence:CCGGCACTGAATTATGGCCTCGAAACTCGAGTTTCGAGGCCATAATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-1563s1c1
Sequence:CCGGGCCATCCTGGATCTTTATATTCTCGAGAATATAAAGATCCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-1394s1c1
Sequence:CCGGCGGAGTTGTGTTACTGCTTAACTCGAGTTAAGCAGTAACACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-2055s1c1
Sequence:CCGGAGGTGCTACATCAACTCAGATCTCGAGATCTGAGTTGATGTAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-611s1c1
Sequence:CCGGCCTGCAACAATATGTCCACAACTCGAGTTGTGGACATATTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173515
VALIDATED
CNKSR3 MISSION shRNA Lentiviral Transduction Particles
CNKSR family member 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1676s21c1
Sequence:CCGGGAAAGCCGGAGACGAAGATTCCTCGAGGAATCTTCGTCTCCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1197s21c1
Sequence:CCGGATGATGGGTTACACGTGATTACTCGAGTAATCACGTGTAACCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1023s21c1
Sequence:CCGGTAGCGGAAATGGAGGATAAAGCTCGAGCTTTATCCTCCATTTCCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1270s21c1
Sequence:CCGGTGACGAAGTCATTCAAGTTAACTCGAGTTAACTTGAATGACTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173515.2-2260s21c1
Sequence:CCGGGTATTATGTAGGGACCTTATGCTCGAGCATAAGGTCCCTACATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1880s21c1
Sequence:CCGGGATGCCCTTTGCCGGTATTTCCTCGAGGAAATACCGGCAAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173515.2-1908s21c1
Sequence:CCGGAGCGGATTCCTCCGATCATTGCTCGAGCAATGATCGGAGGAATCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173515.1-757s1c1
Sequence:CCGGCACTGAATTATGGCCTCGAAACTCGAGTTTCGAGGCCATAATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-1563s1c1
Sequence:CCGGGCCATCCTGGATCTTTATATTCTCGAGAATATAAAGATCCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-1394s1c1
Sequence:CCGGCGGAGTTGTGTTACTGCTTAACTCGAGTTAAGCAGTAACACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-2055s1c1
Sequence:CCGGAGGTGCTACATCAACTCAGATCTCGAGATCTGAGTTGATGTAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173515.1-611s1c1
Sequence:CCGGCCTGCAACAATATGTCCACAACTCGAGTTGTGGACATATTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172546
VALIDATED
CNKSR3 MISSION shRNA Bacterial Glycerol Stock
CNKSR family member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172546.2-2379s21c1
Sequence:CCGGGTCAACCAGAGGGCATCAAATCTCGAGATTTGATGCCCTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172546.2-2307s21c1
Sequence:CCGGCAGTGCTCCGTGGCAACTTTACTCGAGTAAAGTTGCCACGGAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172546.2-1725s21c1
Sequence:CCGGGAGAGCCAAAGACGCAGATTTCTCGAGAAATCTGCGTCTTTGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-2315s1c1
Sequence:CCGGCCGTGGCAACTTTACTTCATTCTCGAGAATGAAGTAAAGTTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-1738s1c1
Sequence:CCGGCGCAGATTTACCATTGCAGATCTCGAGATCTGCAATGGTAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172546.1-624s1c1
Sequence:CCGGGCAGCCATATGTGCACAAGTTCTCGAGAACTTGTGCACATATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-1142s1c1
Sequence:CCGGGCTCTACTACAGACCCTGTTACTCGAGTAACAGGGTCTGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172546
VALIDATED
CNKSR3 MISSION shRNA shRNA Plasmid DNA
CNKSR family member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172546.2-2379s21c1
Sequence:CCGGGTCAACCAGAGGGCATCAAATCTCGAGATTTGATGCCCTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172546.2-2307s21c1
Sequence:CCGGCAGTGCTCCGTGGCAACTTTACTCGAGTAAAGTTGCCACGGAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172546.2-1725s21c1
Sequence:CCGGGAGAGCCAAAGACGCAGATTTCTCGAGAAATCTGCGTCTTTGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-2315s1c1
Sequence:CCGGCCGTGGCAACTTTACTTCATTCTCGAGAATGAAGTAAAGTTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-1738s1c1
Sequence:CCGGCGCAGATTTACCATTGCAGATCTCGAGATCTGCAATGGTAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172546.1-624s1c1
Sequence:CCGGGCAGCCATATGTGCACAAGTTCTCGAGAACTTGTGCACATATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-1142s1c1
Sequence:CCGGGCTCTACTACAGACCCTGTTACTCGAGTAACAGGGTCTGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172546
VALIDATED
CNKSR3 MISSION shRNA Lentiviral Transduction Particles
CNKSR family member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172546.2-2379s21c1
Sequence:CCGGGTCAACCAGAGGGCATCAAATCTCGAGATTTGATGCCCTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172546.2-2307s21c1
Sequence:CCGGCAGTGCTCCGTGGCAACTTTACTCGAGTAAAGTTGCCACGGAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172546.2-1725s21c1
Sequence:CCGGGAGAGCCAAAGACGCAGATTTCTCGAGAAATCTGCGTCTTTGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-2315s1c1
Sequence:CCGGCCGTGGCAACTTTACTTCATTCTCGAGAATGAAGTAAAGTTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-1738s1c1
Sequence:CCGGCGCAGATTTACCATTGCAGATCTCGAGATCTGCAATGGTAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172546.1-624s1c1
Sequence:CCGGGCAGCCATATGTGCACAAGTTCTCGAGAACTTGTGCACATATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172546.1-1142s1c1
Sequence:CCGGGCTCTACTACAGACCCTGTTACTCGAGTAACAGGGTCTGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks