EMAIL THIS PAGE TO A FRIEND

CNN1

calponin 1, basic, smooth muscle

Synonyms: SMCC Sm-Calp
UniProtKB ID: P51911, B2R868, O00638, Q15416, Q8IY93, Q99438
Gene ID:
Mouse(12797) calponin 1
Rat(65204) calponin 1, basic, smooth muscle
chicken(396522) calponin 1, basic, smooth muscle
domestic cat(101100033) calponin 1, basic, smooth muscle
dog(484937) calponin 1, basic, smooth muscle
cow(534583) calponin 1, basic, smooth muscle
domestic guinea pig(100726698) calponin 1, basic, smooth muscle
naked mole-rat(101716932) calponin 1, basic, smooth muscle
sheep(443517) calponin 1, basic, smooth muscle
Gene Class: Cytoskeleton
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500028 Anti-Calponin-1 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP180, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB5500029 Anti-Calponin-1 antibody, Rabbit monoclonal clone SP181, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB5500030 Anti-Calponin-1 antibody, Rabbit monoclonal clone SP193, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB1306519 ANTI-CALPONIN-1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
HPA014263 Anti-CNN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB2100454 Anti-CNN1 antibody produced in rabbit affinity isolated antibody human, bovine, pig, zebrafish, canine, mouse, rat, horse
western blot pricing
C2687 Monoclonal Anti-Calponin antibody produced in mouse clone hCP, ascites fluid human, mouse, rabbit, pig, rat
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
WH0001264M1 Monoclonal Anti-CNN1 antibody produced in mouse clone 2F5-1H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403682 Monoclonal Anti-CNN1 antibody produced in mouse clone 3C7-2A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001299 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001299 Rosetta Predictions human pricing
NM_031747 Rosetta Predictions rat pricing
NM_009922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143420 predicted 1030
2 SASI_Hs02_00331564 predicted 1163
3 SASI_Hs02_00331565 predicted 1178
4 SASI_Hs01_00143421 predicted 1172
5 SASI_Hs01_00143422 predicted 411
6 SASI_Hs02_00331566 predicted 1182
7 SASI_Hs01_00143424 predicted 336
8 SASI_Hs01_00143425 predicted 1171
9 SASI_Hs01_00143426 predicted 368
10 SASI_Hs02_00331567 predicted 692
11 SASI_Hs01_00143423 predicted 643
12 SASI_Hs01_00143427 predicted 754
13 SASI_Hs01_00143428 predicted 427
14 SASI_Hs01_00143429 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060005 predicted 727
2 SASI_Rn01_00060006 predicted 658
3 SASI_Rn01_00060007 predicted 929
4 SASI_Rn01_00060008 predicted 320
5 SASI_Rn01_00060010 predicted 408
6 SASI_Rn01_00060011 predicted 223
7 SASI_Rn01_00060012 predicted 593
8 SASI_Rn01_00060013 predicted 1177
9 SASI_Rn02_00265157 predicted 1226
10 SASI_Rn02_00265158 predicted 400
11 SASI_Rn01_00060009 predicted 337
12 SASI_Rn01_00060014 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113670 predicted 550
2 SASI_Mm01_00113671 predicted 240
3 SASI_Mm01_00113672 predicted 787
4 SASI_Mm01_00113673 predicted 296
5 SASI_Mm02_00317462 predicted 518
6 SASI_Mm01_00113674 predicted 326
7 SASI_Mm01_00113675 predicted 486
8 SASI_Mm01_00113676 predicted 521
9 SASI_Mm01_00113677 predicted 423
10 SASI_Mm01_00113678 predicted 332
11 SASI_Mm01_00113679 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009922
CNN1 MISSION shRNA Bacterial Glycerol Stock
calponin 1, basic, smooth muscle
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009922.2-1404s1c1
Sequence:CCGGCGTTTGTAACTCGAACACATTCTCGAGAATGTGTTCGAGTTACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-632s1c1
Sequence:CCGGCGTCACCTCTATGATCCCAAACTCGAGTTTGGGATCATAGAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-244s1c1
Sequence:CCGGCGGGATCATTCTTTGCGAATTCTCGAGAATTCGCAAAGAATGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-243s1c1
Sequence:CCGGACGGGATCATTCTTTGCGAATCTCGAGATTCGCAAAGAATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-112s1c1
Sequence:CCGGCGGCTTGTCTGCTGAAGTAAACTCGAGTTTACTTCAGCAGACAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009922
CNN1 MISSION shRNA shRNA Plasmid DNA
calponin 1, basic, smooth muscle
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009922.2-1404s1c1
Sequence:CCGGCGTTTGTAACTCGAACACATTCTCGAGAATGTGTTCGAGTTACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-632s1c1
Sequence:CCGGCGTCACCTCTATGATCCCAAACTCGAGTTTGGGATCATAGAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-244s1c1
Sequence:CCGGCGGGATCATTCTTTGCGAATTCTCGAGAATTCGCAAAGAATGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-243s1c1
Sequence:CCGGACGGGATCATTCTTTGCGAATCTCGAGATTCGCAAAGAATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-112s1c1
Sequence:CCGGCGGCTTGTCTGCTGAAGTAAACTCGAGTTTACTTCAGCAGACAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009922
CNN1 MISSION shRNA Lentiviral Transduction Particles
calponin 1, basic, smooth muscle
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009922.2-1404s1c1
Sequence:CCGGCGTTTGTAACTCGAACACATTCTCGAGAATGTGTTCGAGTTACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-632s1c1
Sequence:CCGGCGTCACCTCTATGATCCCAAACTCGAGTTTGGGATCATAGAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-244s1c1
Sequence:CCGGCGGGATCATTCTTTGCGAATTCTCGAGAATTCGCAAAGAATGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-243s1c1
Sequence:CCGGACGGGATCATTCTTTGCGAATCTCGAGATTCGCAAAGAATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009922.2-112s1c1
Sequence:CCGGCGGCTTGTCTGCTGAAGTAAACTCGAGTTTACTTCAGCAGACAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001299
CNN1 MISSION shRNA Bacterial Glycerol Stock
calponin 1, basic, smooth muscle
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-551s1c1
Sequence:CCGGCATGGCGAAGACGAAAGGAAACTCGAGTTTCCTTTCGTCTTCGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001299.4-1172s1c1
Sequence:CCGGGAACTCAACCTCTACAGGGTTCTCGAGAACCCTGTAGAGGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001299.3-383s1c1
Sequence:CCGGGAAGATCAATGAGTCAACCCACTCGAGTGGGTTGACTCATTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-560s1c1
Sequence:CCGGGACGAAAGGAAACAAGGTGAACTCGAGTTCACCTTGTTTCCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-1037s1c1
Sequence:CCGGCAACTACTACAATTCCGCCTACTCGAGTAGGCGGAATTGTAGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001299.4-1256s21c1
Sequence:CCGGGTGCTACAGGGTCCAACATAGCTCGAGCTATGTTGGACCCTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001299.4-1305s21c1
Sequence:CCGGGACGCACTGAGCAACGCTATTCTCGAGAATAGCGTTGCTCAGTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-385s21c1
Sequence:CCGGAGATCAATGAGTCAACCCAAACTCGAGTTTGGGTTGACTCATTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-637s21c1
Sequence:CCGGGAGAAGGGCGGAACATCATTGCTCGAGCAATGATGTTCCGCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-584s21c1
Sequence:CCGGGGGAGTGAAGTACGCAGAGAACTCGAGTTCTCTGCGTACTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-499s21c1
Sequence:CCGGTTGAGAACACCAACCATACACCTCGAGGTGTATGGTTGGTGTTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-310s21c1
Sequence:CCGGACTTCATGGACGGCCTCAAAGCTCGAGCTTTGAGGCCGTCCATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001299
CNN1 MISSION shRNA shRNA Plasmid DNA
calponin 1, basic, smooth muscle
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-551s1c1
Sequence:CCGGCATGGCGAAGACGAAAGGAAACTCGAGTTTCCTTTCGTCTTCGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001299.4-1172s1c1
Sequence:CCGGGAACTCAACCTCTACAGGGTTCTCGAGAACCCTGTAGAGGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001299.3-383s1c1
Sequence:CCGGGAAGATCAATGAGTCAACCCACTCGAGTGGGTTGACTCATTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-560s1c1
Sequence:CCGGGACGAAAGGAAACAAGGTGAACTCGAGTTCACCTTGTTTCCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-1037s1c1
Sequence:CCGGCAACTACTACAATTCCGCCTACTCGAGTAGGCGGAATTGTAGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001299.4-1256s21c1
Sequence:CCGGGTGCTACAGGGTCCAACATAGCTCGAGCTATGTTGGACCCTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001299.4-1305s21c1
Sequence:CCGGGACGCACTGAGCAACGCTATTCTCGAGAATAGCGTTGCTCAGTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-385s21c1
Sequence:CCGGAGATCAATGAGTCAACCCAAACTCGAGTTTGGGTTGACTCATTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-637s21c1
Sequence:CCGGGAGAAGGGCGGAACATCATTGCTCGAGCAATGATGTTCCGCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-584s21c1
Sequence:CCGGGGGAGTGAAGTACGCAGAGAACTCGAGTTCTCTGCGTACTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-499s21c1
Sequence:CCGGTTGAGAACACCAACCATACACCTCGAGGTGTATGGTTGGTGTTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-310s21c1
Sequence:CCGGACTTCATGGACGGCCTCAAAGCTCGAGCTTTGAGGCCGTCCATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001299
CNN1 MISSION shRNA Lentiviral Transduction Particles
calponin 1, basic, smooth muscle
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-551s1c1
Sequence:CCGGCATGGCGAAGACGAAAGGAAACTCGAGTTTCCTTTCGTCTTCGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001299.4-1172s1c1
Sequence:CCGGGAACTCAACCTCTACAGGGTTCTCGAGAACCCTGTAGAGGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001299.3-383s1c1
Sequence:CCGGGAAGATCAATGAGTCAACCCACTCGAGTGGGTTGACTCATTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-560s1c1
Sequence:CCGGGACGAAAGGAAACAAGGTGAACTCGAGTTCACCTTGTTTCCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001299.3-1037s1c1
Sequence:CCGGCAACTACTACAATTCCGCCTACTCGAGTAGGCGGAATTGTAGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001299.4-1256s21c1
Sequence:CCGGGTGCTACAGGGTCCAACATAGCTCGAGCTATGTTGGACCCTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001299.4-1305s21c1
Sequence:CCGGGACGCACTGAGCAACGCTATTCTCGAGAATAGCGTTGCTCAGTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-385s21c1
Sequence:CCGGAGATCAATGAGTCAACCCAAACTCGAGTTTGGGTTGACTCATTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-637s21c1
Sequence:CCGGGAGAAGGGCGGAACATCATTGCTCGAGCAATGATGTTCCGCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-584s21c1
Sequence:CCGGGGGAGTGAAGTACGCAGAGAACTCGAGTTCTCTGCGTACTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-499s21c1
Sequence:CCGGTTGAGAACACCAACCATACACCTCGAGGTGTATGGTTGGTGTTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001299.4-310s21c1
Sequence:CCGGACTTCATGGACGGCCTCAAAGCTCGAGCTTTGAGGCCGTCCATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks