EMAIL THIS PAGE TO A FRIEND

CNN2

calponin 2

49 Gene Product Result for
UniProtKB ID: Q99439, A5D8U8, A6NFI4, D6W5X9, Q92578
Gene ID:
Human(1265) Summary: The protein encoded by this gene, which can bind actin, calmodulin, troponin C, and tropomyosin, may function in the structural organization of actin filaments. The encoded protein could play a role in smooth muscle contraction and cell adhesion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12798) calponin 2
Zebrafish(406658) calponin 2
chicken(100216000) calponin 2
cow(539019) calponin 2
dog(485091) calponin 2
sheep(101115961) calponin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV52039 Anti-CNN2 (AB1) antibody produced in rabbit affinity isolated antibody canine, bovine, zebrafish, rabbit, mouse, guinea pig, human, pig, rat, horse,
western blot pricing
AV52040 Anti-CNN2 (AB2) antibody produced in rabbit affinity isolated antibody zebrafish, guinea pig, mouse, pig, bovine, canine, human
western blot pricing
SAB2501306 Anti-CNN2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405636 Anti-CNN2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA049095 Anti-CNN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500341 Anti-CNN2 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, western blot pricing
C2687 Monoclonal Anti-Calponin antibody produced in mouse clone hCP, ascites fluid human, mouse, rabbit, pig, rat
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
C6047 Monoclonal Anti-Calponin antibody produced in mouse clone CP-93, ascites fluid chicken, turkey, human
electron microscopy, immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004368 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082381 MISSION® esiRNA esiRNA human CNN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004368 Rosetta Predictions human pricing
NM_201277 Rosetta Predictions human pricing
NM_007725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337438 predicted 1774
2 SASI_Hs01_00069602 predicted 1660
3 SASI_Hs01_00069603 predicted 1771
4 SASI_Hs01_00069604 predicted 1774
5 SASI_Hs01_00069605 predicted 1773
6 SASI_Hs01_00069606 predicted 1655
7 SASI_Hs01_00069607 predicted 1597
8 SASI_Hs01_00069608 predicted 1729
9 SASI_Hs01_00069609 predicted 1728
10 SASI_Hs02_00337439 predicted 1635
11 SASI_Hs01_00069610 predicted 1127
12 SASI_Hs01_00069611 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064390 predicted 1554
2 SASI_Hs01_00064391 predicted 1543
3 SASI_Hs01_00064392 predicted 1539
4 SASI_Hs01_00064393 predicted 1485
5 SASI_Hs01_00064394 predicted 1613
6 SASI_Hs01_00064395 predicted 1609
7 SASI_Hs01_00064396 predicted 1519
8 SASI_Hs01_00064398 predicted 1609
9 SASI_Hs01_00064399 predicted 998
10 SASI_Hs02_00372915 predicted 1535
11 SASI_Hs01_00064397 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176540 predicted 1421
2 SASI_Mm02_00312316 predicted 1351
3 SASI_Mm01_00176541 predicted 369
4 SASI_Mm01_00176542 predicted 503
5 SASI_Mm01_00176543 predicted 407
6 SASI_Mm01_00176544 predicted 870
7 SASI_Mm01_00176545 predicted 491
8 SASI_Mm01_00176546 predicted 1454
9 SASI_Mm01_00176547 predicted 1063
10 SASI_Mm01_00176548 predicted 1301
11 SASI_Mm01_00176549 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007725
VALIDATED
CNN2 MISSION shRNA Bacterial Glycerol Stock
calponin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-504s21c1
Sequence:CCGGTGGAGTTAAGTATTCGGAGAACTCGAGTTCTCCGAATACTTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007725.2-1300s21c1
Sequence:CCGGCCAATGGGCTTCCTGTTTCTTCTCGAGAAGAAACAGGAAGCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-342s21c1
Sequence:CCGGCTCCAACTTCATCAAGGCCATCTCGAGATGGCCTTGATGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-759s21c1
Sequence:CCGGGAGGCACATCTATGACACCAACTCGAGTTGGTGTCATAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-1324s1c1
Sequence:CCGGCCAATGGGCTTCCTGTTTCTTCTCGAGAAGAAACAGGAAGCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007725.1-528s1c1
Sequence:CCGGTGGAGTTAAGTATTCGGAGAACTCGAGTTCTCCGAATACTTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007725.1-900s1c1
Sequence:CCGGGCAGATCTACGATCCCAAGTACTCGAGTACTTGGGATCGTAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-366s1c1
Sequence:CCGGCTCCAACTTCATCAAGGCCATCTCGAGATGGCCTTGATGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-783s1c1
Sequence:CCGGGAGGCACATCTATGACACCAACTCGAGTTGGTGTCATAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007725
VALIDATED
CNN2 MISSION shRNA shRNA Plasmid DNA
calponin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-504s21c1
Sequence:CCGGTGGAGTTAAGTATTCGGAGAACTCGAGTTCTCCGAATACTTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007725.2-1300s21c1
Sequence:CCGGCCAATGGGCTTCCTGTTTCTTCTCGAGAAGAAACAGGAAGCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-342s21c1
Sequence:CCGGCTCCAACTTCATCAAGGCCATCTCGAGATGGCCTTGATGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-759s21c1
Sequence:CCGGGAGGCACATCTATGACACCAACTCGAGTTGGTGTCATAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-1324s1c1
Sequence:CCGGCCAATGGGCTTCCTGTTTCTTCTCGAGAAGAAACAGGAAGCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007725.1-528s1c1
Sequence:CCGGTGGAGTTAAGTATTCGGAGAACTCGAGTTCTCCGAATACTTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007725.1-900s1c1
Sequence:CCGGGCAGATCTACGATCCCAAGTACTCGAGTACTTGGGATCGTAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-366s1c1
Sequence:CCGGCTCCAACTTCATCAAGGCCATCTCGAGATGGCCTTGATGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-783s1c1
Sequence:CCGGGAGGCACATCTATGACACCAACTCGAGTTGGTGTCATAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007725
VALIDATED
CNN2 MISSION shRNA Lentiviral Transduction Particles
calponin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-504s21c1
Sequence:CCGGTGGAGTTAAGTATTCGGAGAACTCGAGTTCTCCGAATACTTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007725.2-1300s21c1
Sequence:CCGGCCAATGGGCTTCCTGTTTCTTCTCGAGAAGAAACAGGAAGCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-342s21c1
Sequence:CCGGCTCCAACTTCATCAAGGCCATCTCGAGATGGCCTTGATGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007725.2-759s21c1
Sequence:CCGGGAGGCACATCTATGACACCAACTCGAGTTGGTGTCATAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-1324s1c1
Sequence:CCGGCCAATGGGCTTCCTGTTTCTTCTCGAGAAGAAACAGGAAGCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007725.1-528s1c1
Sequence:CCGGTGGAGTTAAGTATTCGGAGAACTCGAGTTCTCCGAATACTTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007725.1-900s1c1
Sequence:CCGGGCAGATCTACGATCCCAAGTACTCGAGTACTTGGGATCGTAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-366s1c1
Sequence:CCGGCTCCAACTTCATCAAGGCCATCTCGAGATGGCCTTGATGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007725.1-783s1c1
Sequence:CCGGGAGGCACATCTATGACACCAACTCGAGTTGGTGTCATAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004368
VALIDATED
CNN2 MISSION shRNA Bacterial Glycerol Stock
calponin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-521s21c1
Sequence:CCGGGCCTGAAGGATGGAACTATCTCTCGAGAGATAGTTCCATCCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-1047s21c1
Sequence:CCGGGCACATCTATGATACCAAGCTCTCGAGAGCTTGGTATCATAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-917s21c1
Sequence:CCGGGCACGAGAAGGCATCTCTATGCTCGAGCATAGAGATGCCTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-1504s21c1
Sequence:CCGGGGTCAAGGCCATATCCCAATACTCGAGTATTGGGATATGGCCTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-540s21c1
Sequence:CCGGCTTATGCACACTCATGAACAACTCGAGTTGTTCATGAGTGTGCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-521s1c1
Sequence:CCGGGCCTGAAGGATGGAACTATCTCTCGAGAGATAGTTCCATCCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004368.2-522s1c1
Sequence:CCGGCCTGAAGGATGGAACTATCTTCTCGAGAAGATAGTTCCATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004368.2-1047s1c1
Sequence:CCGGGCACATCTATGATACCAAGCTCTCGAGAGCTTGGTATCATAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-540s1c1
Sequence:CCGGCTTATGCACACTCATGAACAACTCGAGTTGTTCATGAGTGTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-529s1c1
Sequence:CCGGGATGGAACTATCTTATGCACACTCGAGTGTGCATAAGATAGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004368
VALIDATED
CNN2 MISSION shRNA shRNA Plasmid DNA
calponin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-521s21c1
Sequence:CCGGGCCTGAAGGATGGAACTATCTCTCGAGAGATAGTTCCATCCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-1047s21c1
Sequence:CCGGGCACATCTATGATACCAAGCTCTCGAGAGCTTGGTATCATAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-917s21c1
Sequence:CCGGGCACGAGAAGGCATCTCTATGCTCGAGCATAGAGATGCCTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-1504s21c1
Sequence:CCGGGGTCAAGGCCATATCCCAATACTCGAGTATTGGGATATGGCCTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-540s21c1
Sequence:CCGGCTTATGCACACTCATGAACAACTCGAGTTGTTCATGAGTGTGCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-521s1c1
Sequence:CCGGGCCTGAAGGATGGAACTATCTCTCGAGAGATAGTTCCATCCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004368.2-522s1c1
Sequence:CCGGCCTGAAGGATGGAACTATCTTCTCGAGAAGATAGTTCCATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004368.2-1047s1c1
Sequence:CCGGGCACATCTATGATACCAAGCTCTCGAGAGCTTGGTATCATAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-540s1c1
Sequence:CCGGCTTATGCACACTCATGAACAACTCGAGTTGTTCATGAGTGTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-529s1c1
Sequence:CCGGGATGGAACTATCTTATGCACACTCGAGTGTGCATAAGATAGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004368
VALIDATED
CNN2 MISSION shRNA Lentiviral Transduction Particles
calponin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-521s21c1
Sequence:CCGGGCCTGAAGGATGGAACTATCTCTCGAGAGATAGTTCCATCCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-1047s21c1
Sequence:CCGGGCACATCTATGATACCAAGCTCTCGAGAGCTTGGTATCATAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-917s21c1
Sequence:CCGGGCACGAGAAGGCATCTCTATGCTCGAGCATAGAGATGCCTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-1504s21c1
Sequence:CCGGGGTCAAGGCCATATCCCAATACTCGAGTATTGGGATATGGCCTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004368.2-540s21c1
Sequence:CCGGCTTATGCACACTCATGAACAACTCGAGTTGTTCATGAGTGTGCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-521s1c1
Sequence:CCGGGCCTGAAGGATGGAACTATCTCTCGAGAGATAGTTCCATCCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004368.2-522s1c1
Sequence:CCGGCCTGAAGGATGGAACTATCTTCTCGAGAAGATAGTTCCATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004368.2-1047s1c1
Sequence:CCGGGCACATCTATGATACCAAGCTCTCGAGAGCTTGGTATCATAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-540s1c1
Sequence:CCGGCTTATGCACACTCATGAACAACTCGAGTTGTTCATGAGTGTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004368.2-529s1c1
Sequence:CCGGGATGGAACTATCTTATGCACACTCGAGTGTGCATAAGATAGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks