EMAIL THIS PAGE TO A FRIEND

CNN3

calponin 3, acidic

123 Gene Product Result for
UniProtKB ID: Q15417, Q6FHA7
Gene ID:
Human(1266) Summary: This gene encodes a protein with a markedly acidic C terminus; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008]
Mouse(71994) calponin 3, acidic
Rat(54321) calponin 3, acidic
chicken(424485) calponin 3, acidic
dog(479937) calponin 3, acidic
domestic cat(101082838) calponin 3, acidic
cow(538975) calponin 3, acidic
domestic guinea pig(100726520) calponin 3, acidic
naked mole-rat(101699411) calponin 3, acidic
sheep(101108091) calponin 3, acidic
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001839 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001839 Rosetta Predictions human pricing
NM_019359 Rosetta Predictions rat pricing
XM_579436 Rosetta Predictions rat pricing
NM_028044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118248 predicted 1198
2 SASI_Hs01_00118250 predicted 1365
3 SASI_Hs01_00118251 predicted 1147
4 SASI_Hs02_00332646 predicted 1172
5 SASI_Hs01_00118252 predicted 556
6 SASI_Hs01_00118253 predicted 816
7 SASI_Hs01_00118254 predicted 346
8 SASI_Hs02_00332647 predicted 538
9 SASI_Hs01_00118256 predicted 1319
10 SASI_Hs02_00332648 predicted 976
11 SASI_Hs01_00118249 predicted 411
12 SASI_Hs01_00118255 predicted 550
13 SASI_Hs01_00118257 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033898 predicted 637
2 SASI_Rn01_00033899 predicted 675
3 SASI_Rn02_00262370 predicted 1292
4 SASI_Rn01_00033900 predicted 1286
5 SASI_Rn01_00033901 predicted 1121
6 SASI_Rn01_00033902 predicted 754
7 SASI_Rn02_00262371 predicted 969
8 SASI_Rn01_00033903 predicted 1166
9 SASI_Rn01_00033906 predicted 386
10 SASI_Rn01_00033907 predicted 483
11 SASI_Rn01_00033904 predicted 630
12 SASI_Rn01_00033905 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579436 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140907 predicted 644
2 SASI_Rn01_00140908 predicted 681
3 SASI_Rn01_00140909 predicted 1291
4 SASI_Rn01_00140910 predicted 1310
5 SASI_Rn01_00140911 predicted 1122
6 SASI_Rn01_00140912 predicted 762
7 SASI_Rn01_00140913 predicted 400
8 SASI_Rn01_00140914 predicted 1167
9 SASI_Rn01_00140915 predicted 496
10 SASI_Rn01_00140916 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333218 predicted 309
2 SASI_Mm01_00159666 predicted 388
3 SASI_Mm02_00333219 predicted 498
4 SASI_Mm02_00333220 predicted 1321
5 SASI_Mm01_00159657 predicted 1309
6 SASI_Mm01_00159660 predicted 973
7 SASI_Mm01_00159661 predicted 1118
8 SASI_Mm01_00159662 predicted 1241
9 SASI_Mm01_00159664 predicted 1304
10 SASI_Mm01_00159665 predicted 1270
11 SASI_Mm01_00159658 predicted 638
12 SASI_Mm01_00159659 predicted 450
13 SASI_Mm01_00159663 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028044
VALIDATED
CNN3 MISSION shRNA Bacterial Glycerol Stock
calponin 3, acidic
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-1242s1c1
Sequence:CCGGCGCAGTATTTAGTCCATTGTTCTCGAGAACAATGGACTAAATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-273s1c1
Sequence:CCGGGCCGAAGTTAAGAACAAGATTCTCGAGAATCTTGTTCTTAACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-1148s1c1
Sequence:CCGGCGATGAATATCATGGCGAGTACTCGAGTACTCGCCATGATATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-272s1c1
Sequence:CCGGCGCCGAAGTTAAGAACAAGATCTCGAGATCTTGTTCTTAACTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-491s1c1
Sequence:CCGGCGGCAACTTCATTAAAGCTATCTCGAGATAGCTTTAATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-270s21c1
Sequence:CCGGCGCCGAAGTTAAGAACAAGATCTCGAGATCTTGTTCTTAACTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028044.2-1240s21c1
Sequence:CCGGCGCAGTATTTAGTCCATTGTTCTCGAGAACAATGGACTAAATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-1146s21c1
Sequence:CCGGCGATGAATATCATGGCGAGTACTCGAGTACTCGCCATGATATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-489s21c1
Sequence:CCGGCGGCAACTTCATTAAAGCTATCTCGAGATAGCTTTAATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028044
VALIDATED
CNN3 MISSION shRNA shRNA Plasmid DNA
calponin 3, acidic
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-1242s1c1
Sequence:CCGGCGCAGTATTTAGTCCATTGTTCTCGAGAACAATGGACTAAATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-273s1c1
Sequence:CCGGGCCGAAGTTAAGAACAAGATTCTCGAGAATCTTGTTCTTAACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-1148s1c1
Sequence:CCGGCGATGAATATCATGGCGAGTACTCGAGTACTCGCCATGATATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-272s1c1
Sequence:CCGGCGCCGAAGTTAAGAACAAGATCTCGAGATCTTGTTCTTAACTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-491s1c1
Sequence:CCGGCGGCAACTTCATTAAAGCTATCTCGAGATAGCTTTAATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-270s21c1
Sequence:CCGGCGCCGAAGTTAAGAACAAGATCTCGAGATCTTGTTCTTAACTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028044.2-1240s21c1
Sequence:CCGGCGCAGTATTTAGTCCATTGTTCTCGAGAACAATGGACTAAATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-1146s21c1
Sequence:CCGGCGATGAATATCATGGCGAGTACTCGAGTACTCGCCATGATATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-489s21c1
Sequence:CCGGCGGCAACTTCATTAAAGCTATCTCGAGATAGCTTTAATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028044
VALIDATED
CNN3 MISSION shRNA Lentiviral Transduction Particles
calponin 3, acidic
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-1242s1c1
Sequence:CCGGCGCAGTATTTAGTCCATTGTTCTCGAGAACAATGGACTAAATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-273s1c1
Sequence:CCGGGCCGAAGTTAAGAACAAGATTCTCGAGAATCTTGTTCTTAACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-1148s1c1
Sequence:CCGGCGATGAATATCATGGCGAGTACTCGAGTACTCGCCATGATATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-272s1c1
Sequence:CCGGCGCCGAAGTTAAGAACAAGATCTCGAGATCTTGTTCTTAACTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028044.1-491s1c1
Sequence:CCGGCGGCAACTTCATTAAAGCTATCTCGAGATAGCTTTAATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-270s21c1
Sequence:CCGGCGCCGAAGTTAAGAACAAGATCTCGAGATCTTGTTCTTAACTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028044.2-1240s21c1
Sequence:CCGGCGCAGTATTTAGTCCATTGTTCTCGAGAACAATGGACTAAATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-1146s21c1
Sequence:CCGGCGATGAATATCATGGCGAGTACTCGAGTACTCGCCATGATATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028044.2-489s21c1
Sequence:CCGGCGGCAACTTCATTAAAGCTATCTCGAGATAGCTTTAATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001839
VALIDATED
CNN3 MISSION shRNA Bacterial Glycerol Stock
calponin 3, acidic
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001839.1-123s1c1
Sequence:CCGGGCCGAAGTCAAGAACAAGATTCTCGAGAATCTTGTTCTTGACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-638s1c1
Sequence:CCGGGAGGCATCTTTATGATCCCAACTCGAGTTGGGATCATAAAGATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-686s1c1
Sequence:CCGGGACCACAATTAGTCTGCAGATCTCGAGATCTGCAGACTAATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001839.1-366s1c1
Sequence:CCGGGCTTATGGTATGAAGCCACATCTCGAGATGTGGCTTCATACCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-165s1c1
Sequence:CCGGGCAGAAGAAGATCTTCGCAATCTCGAGATTGCGAAGATCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-1038s1c1
Sequence:CCGGGATTACCAATATAGCGACCAACTCGAGTTGGTCGCTATATTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-134s1c1
Sequence:CCGGGAACAAGATTGCTTCCAAGTACTCGAGTACTTGGAAGCAATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-961s1c1
Sequence:CCGGCGGAAATCAGTGATAGTGATTCTCGAGAATCACTATCACTGATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-367s21c1
Sequence:CCGGGCAGAAGAAGATCTTCGCAATCTCGAGATTGCGAAGATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-1240s21c1
Sequence:CCGGGATTACCAATATAGCGACCAACTCGAGTTGGTCGCTATATTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-325s21c1
Sequence:CCGGGCCGAAGTCAAGAACAAGATTCTCGAGAATCTTGTTCTTGACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001839.3-888s21c1
Sequence:CCGGGACCACAATTAGTCTGCAGATCTCGAGATCTGCAGACTAATTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001839
VALIDATED
CNN3 MISSION shRNA shRNA Plasmid DNA
calponin 3, acidic
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001839.1-123s1c1
Sequence:CCGGGCCGAAGTCAAGAACAAGATTCTCGAGAATCTTGTTCTTGACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-638s1c1
Sequence:CCGGGAGGCATCTTTATGATCCCAACTCGAGTTGGGATCATAAAGATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-686s1c1
Sequence:CCGGGACCACAATTAGTCTGCAGATCTCGAGATCTGCAGACTAATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001839.1-366s1c1
Sequence:CCGGGCTTATGGTATGAAGCCACATCTCGAGATGTGGCTTCATACCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-165s1c1
Sequence:CCGGGCAGAAGAAGATCTTCGCAATCTCGAGATTGCGAAGATCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-1038s1c1
Sequence:CCGGGATTACCAATATAGCGACCAACTCGAGTTGGTCGCTATATTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-134s1c1
Sequence:CCGGGAACAAGATTGCTTCCAAGTACTCGAGTACTTGGAAGCAATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-961s1c1
Sequence:CCGGCGGAAATCAGTGATAGTGATTCTCGAGAATCACTATCACTGATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-367s21c1
Sequence:CCGGGCAGAAGAAGATCTTCGCAATCTCGAGATTGCGAAGATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-1240s21c1
Sequence:CCGGGATTACCAATATAGCGACCAACTCGAGTTGGTCGCTATATTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-325s21c1
Sequence:CCGGGCCGAAGTCAAGAACAAGATTCTCGAGAATCTTGTTCTTGACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001839.3-888s21c1
Sequence:CCGGGACCACAATTAGTCTGCAGATCTCGAGATCTGCAGACTAATTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001839
VALIDATED
CNN3 MISSION shRNA Lentiviral Transduction Particles
calponin 3, acidic
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001839.1-123s1c1
Sequence:CCGGGCCGAAGTCAAGAACAAGATTCTCGAGAATCTTGTTCTTGACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-638s1c1
Sequence:CCGGGAGGCATCTTTATGATCCCAACTCGAGTTGGGATCATAAAGATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-686s1c1
Sequence:CCGGGACCACAATTAGTCTGCAGATCTCGAGATCTGCAGACTAATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001839.1-366s1c1
Sequence:CCGGGCTTATGGTATGAAGCCACATCTCGAGATGTGGCTTCATACCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-165s1c1
Sequence:CCGGGCAGAAGAAGATCTTCGCAATCTCGAGATTGCGAAGATCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001839.1-1038s1c1
Sequence:CCGGGATTACCAATATAGCGACCAACTCGAGTTGGTCGCTATATTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-134s1c1
Sequence:CCGGGAACAAGATTGCTTCCAAGTACTCGAGTACTTGGAAGCAATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001839.1-961s1c1
Sequence:CCGGCGGAAATCAGTGATAGTGATTCTCGAGAATCACTATCACTGATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-367s21c1
Sequence:CCGGGCAGAAGAAGATCTTCGCAATCTCGAGATTGCGAAGATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-1240s21c1
Sequence:CCGGGATTACCAATATAGCGACCAACTCGAGTTGGTCGCTATATTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001839.3-325s21c1
Sequence:CCGGGCCGAAGTCAAGAACAAGATTCTCGAGAATCTTGTTCTTGACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001839.3-888s21c1
Sequence:CCGGGACCACAATTAGTCTGCAGATCTCGAGATCTGCAGACTAATTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks