EMAIL THIS PAGE TO A FRIEND

CNNM2

cyclin M2

120 Gene Product Result for
Synonyms: ACDP2
Gene ID:
Human(54805) Summary: This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+. Mutations in this gene are associated with renal hypomagnesemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(94219) cyclin M2
Rat(294014) cyclin M2
Goat(100861072) cyclin M2
sheep(101109844) cyclin M2
chicken(428975) cyclin M2
dog(486866) cyclin M2
cow(504632) cyclin M2
Horse(100059801) cyclin M2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017649 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU195571 MISSION® esiRNA esiRNA targeting mouse Cnnm2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017649 Rosetta Predictions human pricing
NM_199076 Rosetta Predictions human pricing
NM_199077 Rosetta Predictions human pricing
NM_001011942 Rosetta Predictions rat pricing
XM_574680 Rosetta Predictions rat pricing
NM_001102471 Rosetta Predictions mouse pricing
NM_033569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086300 predicted 843
2 SASI_Hs01_00086301 predicted 1394
3 SASI_Hs01_00086302 predicted 1387
4 SASI_Hs01_00086303 predicted 1053
5 SASI_Hs01_00086304 predicted 1171
6 SASI_Hs01_00086305 predicted 1328
7 SASI_Hs01_00086306 predicted 925
8 SASI_Hs01_00086307 predicted 1157
9 SASI_Hs01_00086308 predicted 1283
10 SASI_Hs01_00086309 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031984 predicted 844
2 SASI_Hs01_00031985 predicted 1398
3 SASI_Hs01_00031986 predicted 1391
4 SASI_Hs01_00031987 predicted 1050
5 SASI_Hs01_00031988 predicted 1174
6 SASI_Hs01_00031989 predicted 1331
7 SASI_Hs01_00031990 predicted 931
8 SASI_Hs01_00031991 predicted 1157
9 SASI_Hs01_00031992 predicted 1283
10 SASI_Hs01_00031993 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196140 predicted 837
2 SASI_Hs01_00196141 predicted 1394
3 SASI_Hs01_00196142 predicted 1385
4 SASI_Hs01_00196143 predicted 1052
5 SASI_Hs01_00196144 predicted 1174
6 SASI_Hs01_00196145 predicted 1333
7 SASI_Hs01_00196146 predicted 929
8 SASI_Hs01_00196147 predicted 1166
9 SASI_Hs01_00196148 predicted 1280
10 SASI_Hs01_00196149 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053614 predicted 616
2 SASI_Rn01_00053615 predicted 2013
3 SASI_Rn01_00053616 predicted 1268
4 SASI_Rn01_00053617 predicted 1815
5 SASI_Rn01_00053618 predicted 1910
6 SASI_Rn01_00053619 predicted 1742
7 SASI_Rn01_00053620 predicted 1892
8 SASI_Rn01_00053621 predicted 2153
9 SASI_Rn01_00053622 predicted 2220
10 SASI_Rn01_00053623 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175951 predicted 693
2 SASI_Rn01_00175952 predicted 2086
3 SASI_Rn01_00175953 predicted 1347
4 SASI_Rn01_00175954 predicted 1895
5 SASI_Rn01_00175955 predicted 1988
6 SASI_Rn01_00175956 predicted 1812
7 SASI_Rn01_00175957 predicted 1961
8 SASI_Rn01_00175958 predicted 2220
9 SASI_Rn01_00175959 predicted 2290
10 SASI_Rn01_00175960 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302913 predicted 671
2 SASI_Mm02_00302914 predicted 1794
3 SASI_Mm02_00302915 predicted 2645
4 SASI_Mm02_00302916 predicted 1877
5 SASI_Mm02_00302917 predicted 1968
6 SASI_Mm02_00302918 predicted 1434
7 SASI_Mm02_00302919 predicted 2075
8 SASI_Mm02_00302920 predicted 1867
9 SASI_Mm02_00302921 predicted 1321
10 SASI_Mm02_00302922 predicted 1842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337397 predicted 669
2 SASI_Mm01_00180885 predicted 1800
3 SASI_Mm02_00337398 predicted 2714
4 SASI_Mm01_00180886 predicted 1873
5 SASI_Mm01_00180887 predicted 1973
6 SASI_Mm01_00180888 predicted 1434
7 SASI_Mm02_00337399 predicted 2072
8 SASI_Mm02_00337400 predicted 1859
9 SASI_Mm02_00337401 predicted 1323
10 SASI_Mm02_00337402 predicted 1845
11 SASI_Mm01_00180889 predicted 1526
12 SASI_Mm01_00180890 predicted 1530
13 SASI_Mm01_00180891 predicted 1097
14 SASI_Mm01_00180892 predicted 1577
15 SASI_Mm01_00180893 predicted 1828
16 SASI_Mm01_00180894 predicted 1843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033569
VALIDATED
CNNM2 MISSION shRNA Bacterial Glycerol Stock
cyclin M2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-1949s1c1
Sequence:CCGGCCTCAGTCTTCAGACAGTGAACTCGAGTTCACTGTCTGAAGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033569.1-2458s1c1
Sequence:CCGGGCAGAGTTTGAAGTTGGTCTTCTCGAGAAGACCAACTTCAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-2323s1c1
Sequence:CCGGCCACCCAAATAGAATCATGTTCTCGAGAACATGATTCTATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-640s1c1
Sequence:CCGGCGCTTCTTATCCGGTTAGCAACTCGAGTTGCTAACCGGATAAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-528s1c1
Sequence:CCGGGCATCGTCATCTTCGGAGAAACTCGAGTTTCTCCGAAGATGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-247s1c1
Sequence:CCGGGCAAGTGATCTTCATCTCGCTCTCGAGAGCGAGATGAAGATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033569.1-2365s1c1
Sequence:CCGGCGTTTCTTTCATCCCTCAATTCTCGAGAATTGAGGGATGAAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033569.1-955s1c1
Sequence:CCGGCCTGCTCTTTGTCAAAGACTTCTCGAGAAGTCTTTGACAAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-1522s1c1
Sequence:CCGGCGTAGACTACTTCGTCCTCATCTCGAGATGAGGACGAAGTAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.3-678s1c1
Sequence:CCGGATCATCGAGATCGAGATTAAACTCGAGTTTAATCTCGATCTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033569
VALIDATED
CNNM2 MISSION shRNA shRNA Plasmid DNA
cyclin M2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-1949s1c1
Sequence:CCGGCCTCAGTCTTCAGACAGTGAACTCGAGTTCACTGTCTGAAGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033569.1-2458s1c1
Sequence:CCGGGCAGAGTTTGAAGTTGGTCTTCTCGAGAAGACCAACTTCAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-2323s1c1
Sequence:CCGGCCACCCAAATAGAATCATGTTCTCGAGAACATGATTCTATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-640s1c1
Sequence:CCGGCGCTTCTTATCCGGTTAGCAACTCGAGTTGCTAACCGGATAAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-528s1c1
Sequence:CCGGGCATCGTCATCTTCGGAGAAACTCGAGTTTCTCCGAAGATGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-247s1c1
Sequence:CCGGGCAAGTGATCTTCATCTCGCTCTCGAGAGCGAGATGAAGATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033569.1-2365s1c1
Sequence:CCGGCGTTTCTTTCATCCCTCAATTCTCGAGAATTGAGGGATGAAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033569.1-955s1c1
Sequence:CCGGCCTGCTCTTTGTCAAAGACTTCTCGAGAAGTCTTTGACAAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-1522s1c1
Sequence:CCGGCGTAGACTACTTCGTCCTCATCTCGAGATGAGGACGAAGTAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.3-678s1c1
Sequence:CCGGATCATCGAGATCGAGATTAAACTCGAGTTTAATCTCGATCTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033569
VALIDATED
CNNM2 MISSION shRNA Lentiviral Transduction Particles
cyclin M2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-1949s1c1
Sequence:CCGGCCTCAGTCTTCAGACAGTGAACTCGAGTTCACTGTCTGAAGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033569.1-2458s1c1
Sequence:CCGGGCAGAGTTTGAAGTTGGTCTTCTCGAGAAGACCAACTTCAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-2323s1c1
Sequence:CCGGCCACCCAAATAGAATCATGTTCTCGAGAACATGATTCTATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-640s1c1
Sequence:CCGGCGCTTCTTATCCGGTTAGCAACTCGAGTTGCTAACCGGATAAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-528s1c1
Sequence:CCGGGCATCGTCATCTTCGGAGAAACTCGAGTTTCTCCGAAGATGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033569.1-247s1c1
Sequence:CCGGGCAAGTGATCTTCATCTCGCTCTCGAGAGCGAGATGAAGATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033569.1-2365s1c1
Sequence:CCGGCGTTTCTTTCATCCCTCAATTCTCGAGAATTGAGGGATGAAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033569.1-955s1c1
Sequence:CCGGCCTGCTCTTTGTCAAAGACTTCTCGAGAAGTCTTTGACAAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.1-1522s1c1
Sequence:CCGGCGTAGACTACTTCGTCCTCATCTCGAGATGAGGACGAAGTAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_033569.3-678s1c1
Sequence:CCGGATCATCGAGATCGAGATTAAACTCGAGTTTAATCTCGATCTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017649
CNNM2 MISSION shRNA Bacterial Glycerol Stock
cyclin M2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017649.3-2996s1c1
Sequence:CCGGGCCCAAATAGAATCATGTTTACTCGAGTAAACATGATTCTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-2454s1c1
Sequence:CCGGGCAGCAATAACCAGCTCAATTCTCGAGAATTGAGCTGGTTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-1341s1c1
Sequence:CCGGGCACCGTCTATAACCGGGAAACTCGAGTTTCCCGGTTATAGACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-1921s1c1
Sequence:CCGGCCGGGAACGAAAGCAAGATTTCTCGAGAAATCTTGCTTTCGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-2598s1c1
Sequence:CCGGCCCAGTCTTCAGACAGTGAAACTCGAGTTTCACTGTCTGAAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017649.3-1720s21c1
Sequence:CCGGCGCTATGCTGGAAGAATTTAACTCGAGTTAAATTCTTCCAGCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017649.3-1961s21c1
Sequence:CCGGGACAGTGAGATGAAGGTTAAACTCGAGTTTAACCTTCATCTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017649
CNNM2 MISSION shRNA shRNA Plasmid DNA
cyclin M2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017649.3-2996s1c1
Sequence:CCGGGCCCAAATAGAATCATGTTTACTCGAGTAAACATGATTCTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-2454s1c1
Sequence:CCGGGCAGCAATAACCAGCTCAATTCTCGAGAATTGAGCTGGTTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-1341s1c1
Sequence:CCGGGCACCGTCTATAACCGGGAAACTCGAGTTTCCCGGTTATAGACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-1921s1c1
Sequence:CCGGCCGGGAACGAAAGCAAGATTTCTCGAGAAATCTTGCTTTCGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-2598s1c1
Sequence:CCGGCCCAGTCTTCAGACAGTGAAACTCGAGTTTCACTGTCTGAAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017649.3-1720s21c1
Sequence:CCGGCGCTATGCTGGAAGAATTTAACTCGAGTTAAATTCTTCCAGCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017649.3-1961s21c1
Sequence:CCGGGACAGTGAGATGAAGGTTAAACTCGAGTTTAACCTTCATCTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017649
CNNM2 MISSION shRNA Lentiviral Transduction Particles
cyclin M2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017649.3-2996s1c1
Sequence:CCGGGCCCAAATAGAATCATGTTTACTCGAGTAAACATGATTCTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-2454s1c1
Sequence:CCGGGCAGCAATAACCAGCTCAATTCTCGAGAATTGAGCTGGTTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-1341s1c1
Sequence:CCGGGCACCGTCTATAACCGGGAAACTCGAGTTTCCCGGTTATAGACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-1921s1c1
Sequence:CCGGCCGGGAACGAAAGCAAGATTTCTCGAGAAATCTTGCTTTCGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017649.3-2598s1c1
Sequence:CCGGCCCAGTCTTCAGACAGTGAAACTCGAGTTTCACTGTCTGAAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017649.3-1720s21c1
Sequence:CCGGCGCTATGCTGGAAGAATTTAACTCGAGTTAAATTCTTCCAGCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017649.3-1961s21c1
Sequence:CCGGGACAGTGAGATGAAGGTTAAACTCGAGTTTAACCTTCATCTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks