EMAIL THIS PAGE TO A FRIEND

CNNM3

cyclin M3

69 Gene Product Result for
Synonyms: ACDP3
UniProtKB ID: Q8NE01, B3KX67, Q8TBV4, Q96IW4, Q9NRK4, Q9NXW6
Gene ID:
Mouse(94218) cyclin M3
Rat(301345) cyclin M3
cow(100138153) cyclin M3
dog(481345) cyclin M3
sheep(101114184) cyclin M3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017623 Rosetta Predictions human pricing
NM_199078 Rosetta Predictions human pricing
NM_001106901 Rosetta Predictions rat pricing
NM_001039551 Rosetta Predictions mouse pricing
NM_053186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024281 predicted 2532
2 SASI_Hs01_00024282 predicted 2502
3 SASI_Hs01_00024283 predicted 2025
4 SASI_Hs01_00024284 predicted 1870
5 SASI_Hs01_00024285 predicted 1880
6 SASI_Hs01_00024286 predicted 1933
7 SASI_Hs01_00024287 predicted 2626
8 SASI_Hs01_00024288 predicted 2450
9 SASI_Hs02_00350298 predicted 1713
10 SASI_Hs02_00350299 predicted 1839
11 SASI_Hs01_00024280 predicted 2399
12 SASI_Hs01_00024289 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038160 predicted 2393
2 SASI_Hs01_00038161 predicted 2358
3 SASI_Hs01_00038162 predicted 1882
4 SASI_Hs01_00038163 predicted 1727
5 SASI_Hs01_00038164 predicted 1737
6 SASI_Hs01_00038165 predicted 1786
7 SASI_Hs01_00038166 predicted 2485
8 SASI_Hs01_00038167 predicted 2312
9 SASI_Hs02_00372555 predicted 1574
10 SASI_Hs02_00372556 predicted 1696
11 SASI_Hs01_00038159 predicted 2254
12 SASI_Hs01_00038168 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223526 predicted 1510
2 SASI_Rn02_00223527 predicted 1426
3 SASI_Rn02_00223528 predicted 1941
4 SASI_Rn02_00223529 predicted 1560
5 SASI_Rn02_00223530 predicted 1145
6 SASI_Rn02_00223531 predicted 1407
7 SASI_Rn02_00223532 predicted 1824
8 SASI_Rn02_00223533 predicted 2189
9 SASI_Rn02_00223534 predicted 1635
10 SASI_Rn02_00223535 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138590 predicted 1128
2 SASI_Mm01_00138591 predicted 2599
3 SASI_Mm01_00138592 predicted 1583
4 SASI_Mm01_00138593 predicted 1644
5 SASI_Mm01_00138594 predicted 1706
6 SASI_Mm01_00138596 predicted 207
7 SASI_Mm01_00138597 predicted 1184
8 SASI_Mm01_00138598 predicted 1503
9 SASI_Mm01_00138599 predicted 2601
10 SASI_Mm02_00290130 predicted 1145
11 SASI_Mm01_00138595 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337746 predicted 1123
2 SASI_Mm01_00198618 predicted 2499
3 SASI_Mm01_00198619 predicted 1586
4 SASI_Mm01_00198620 predicted 1643
5 SASI_Mm01_00198621 predicted 1713
6 SASI_Mm01_00198623 predicted 212
7 SASI_Mm01_00198624 predicted 1189
8 SASI_Mm01_00198625 predicted 1503
9 SASI_Mm01_00198626 predicted 2498
10 SASI_Mm01_00198627 predicted 1138
11 SASI_Mm01_00198622 predicted 1606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053186
VALIDATED
CNNM3 MISSION shRNA Bacterial Glycerol Stock
cyclin M3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-215s1c2
Sequence:CCGGCTCAAAGACTTGGCTATCGTTCTCGAGAACGATAGCCAAGTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-985s1c1
Sequence:CCGGCTGCACATACTGTCCTGACTACTCGAGTAGTCAGGACAGTATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053186.1-778s1c1
Sequence:CCGGCCAGCCAGTAGATTACTTCATCTCGAGATGAAGTAATCTACTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053186.1-1268s1c1
Sequence:CCGGGCTGGAAATGGACAAGCGTTTCTCGAGAAACGCTTGTCCATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-664s1c1
Sequence:CCGGGCGAGTCTCTGAGAAAGTCTTCTCGAGAAGACTTTCTCAGAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053186
VALIDATED
CNNM3 MISSION shRNA shRNA Plasmid DNA
cyclin M3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-215s1c2
Sequence:CCGGCTCAAAGACTTGGCTATCGTTCTCGAGAACGATAGCCAAGTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-985s1c1
Sequence:CCGGCTGCACATACTGTCCTGACTACTCGAGTAGTCAGGACAGTATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053186.1-778s1c1
Sequence:CCGGCCAGCCAGTAGATTACTTCATCTCGAGATGAAGTAATCTACTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053186.1-1268s1c1
Sequence:CCGGGCTGGAAATGGACAAGCGTTTCTCGAGAAACGCTTGTCCATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-664s1c1
Sequence:CCGGGCGAGTCTCTGAGAAAGTCTTCTCGAGAAGACTTTCTCAGAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053186
VALIDATED
CNNM3 MISSION shRNA Lentiviral Transduction Particles
cyclin M3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-215s1c2
Sequence:CCGGCTCAAAGACTTGGCTATCGTTCTCGAGAACGATAGCCAAGTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-985s1c1
Sequence:CCGGCTGCACATACTGTCCTGACTACTCGAGTAGTCAGGACAGTATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053186.1-778s1c1
Sequence:CCGGCCAGCCAGTAGATTACTTCATCTCGAGATGAAGTAATCTACTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053186.1-1268s1c1
Sequence:CCGGGCTGGAAATGGACAAGCGTTTCTCGAGAAACGCTTGTCCATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053186.1-664s1c1
Sequence:CCGGGCGAGTCTCTGAGAAAGTCTTCTCGAGAAGACTTTCTCAGAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017623
CNNM3 MISSION shRNA Bacterial Glycerol Stock
cyclin M3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1469s1c1
Sequence:CCGGAGGTGTCTGATGATGAATATACTCGAGTATATTCATCATCAGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1741s1c1
Sequence:CCGGGAGGGTCTGAAGTTTGAGAATCTCGAGATTCTCAAACTTCAGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1197s1c1
Sequence:CCGGCTTCGTCTTCAACGACACCAACTCGAGTTGGTGTCGTTGAAGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1683s1c1
Sequence:CCGGGCCGGTGGATTACTTCATTCTCTCGAGAGAATGAAGTAATCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1877s1c1
Sequence:CCGGGCACGCATTCATCTGCGTATTCTCGAGAATACGCAGATGAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017623
CNNM3 MISSION shRNA shRNA Plasmid DNA
cyclin M3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1469s1c1
Sequence:CCGGAGGTGTCTGATGATGAATATACTCGAGTATATTCATCATCAGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1741s1c1
Sequence:CCGGGAGGGTCTGAAGTTTGAGAATCTCGAGATTCTCAAACTTCAGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1197s1c1
Sequence:CCGGCTTCGTCTTCAACGACACCAACTCGAGTTGGTGTCGTTGAAGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1683s1c1
Sequence:CCGGGCCGGTGGATTACTTCATTCTCTCGAGAGAATGAAGTAATCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1877s1c1
Sequence:CCGGGCACGCATTCATCTGCGTATTCTCGAGAATACGCAGATGAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017623
CNNM3 MISSION shRNA Lentiviral Transduction Particles
cyclin M3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1469s1c1
Sequence:CCGGAGGTGTCTGATGATGAATATACTCGAGTATATTCATCATCAGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1741s1c1
Sequence:CCGGGAGGGTCTGAAGTTTGAGAATCTCGAGATTCTCAAACTTCAGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1197s1c1
Sequence:CCGGCTTCGTCTTCAACGACACCAACTCGAGTTGGTGTCGTTGAAGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1683s1c1
Sequence:CCGGGCCGGTGGATTACTTCATTCTCTCGAGAGAATGAAGTAATCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017623.3-1877s1c1
Sequence:CCGGGCACGCATTCATCTGCGTATTCTCGAGAATACGCAGATGAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks