EMAIL THIS PAGE TO A FRIEND

CNNM4

cyclin M4

91 Gene Product Result for
Synonyms: ACDP4
UniProtKB ID: Q6P4Q7, Q53RE5, Q9H9G3, Q9HCI0, Q9NRN1
Gene ID:
Human(26504) Summary: This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play a role in metal ion transport. Mutations in this gene are associated with Jalili syndrome which consists of cone-rod dystrophy and amelogenesis imperfecta. [provided by RefSeq, Feb 2010]
Mouse(94220) cyclin M4
Rat(363216) cyclin M4
sheep(101110923) cyclin M4
cow(522382) cyclin M4
Horse(100062145) cyclin M4
dog(481346) cyclin M4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020184 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020184 Rosetta Predictions human pricing
XM_001056626 Rosetta Predictions rat pricing
XM_343554 Rosetta Predictions rat pricing
NM_033570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215988 predicted 2376
2 SASI_Hs01_00215989 predicted 1284
3 SASI_Hs02_00353101 predicted 1416
4 SASI_Hs01_00215990 predicted 1629
5 SASI_Hs01_00215991 predicted 1911
6 SASI_Hs01_00215992 predicted 2394
7 SASI_Hs01_00215993 predicted 1348
8 SASI_Hs01_00215995 predicted 2171
9 SASI_Hs01_00215996 predicted 1894
10 SASI_Hs02_00353102 predicted 1671
11 SASI_Hs01_00215987 predicted 1015
12 SASI_Hs01_00215994 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283871 predicted 2161
2 SASI_Rn02_00283872 predicted 1666
3 SASI_Rn02_00283873 predicted 1083
4 SASI_Rn02_00283874 predicted 1140
5 SASI_Rn02_00283875 predicted 1690
6 SASI_Rn02_00283876 predicted 760
7 SASI_Rn02_00283877 predicted 345
8 SASI_Rn02_00283878 predicted 2077
9 SASI_Rn02_00283879 predicted 2132
10 SASI_Rn02_00283880 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396008 predicted 1338
2 SASI_Rn02_00396009 predicted 1660
3 SASI_Rn02_00396010 predicted 1074
4 SASI_Rn02_00396011 predicted 1698
5 SASI_Rn02_00396012 predicted 1139
6 SASI_Rn02_00396013 predicted 1691
7 SASI_Rn02_00396014 predicted 758
8 SASI_Rn02_00396015 predicted 345
9 SASI_Rn02_00396016 predicted 1635
10 SASI_Rn02_00396017 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161740 predicted 2157
2 SASI_Mm01_00161741 predicted 1325
3 SASI_Mm01_00161742 predicted 2160
4 SASI_Mm01_00161743 predicted 906
5 SASI_Mm01_00161744 predicted 1408
6 SASI_Mm01_00161745 predicted 1126
7 SASI_Mm01_00161746 predicted 1072
8 SASI_Mm01_00161747 predicted 1695
9 SASI_Mm01_00161748 predicted 757
10 SASI_Mm01_00161749 predicted 2073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020184
CNNM4 MISSION shRNA Bacterial Glycerol Stock
cyclin M4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-904s1c1
Sequence:CCGGGCCCTATAATGACCTCGTGAACTCGAGTTCACGAGGTCATTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-844s1c1
Sequence:CCGGCCAGGAGATTCGCACTGTTTACTCGAGTAAACAGTGCGAATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-1099s1c1
Sequence:CCGGGCAGTCCAATATTGTAGATATCTCGAGATATCTACAATATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-2116s1c1
Sequence:CCGGCGAGACCACAACTCTTCTCAACTCGAGTTGAGAAGAGTTGTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-1966s1c1
Sequence:CCGGCGTGGACTTGCAGTACATCAACTCGAGTTGATGTACTGCAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020184.3-2810s21c1
Sequence:CCGGCCGGGAAGCAACGGACATAATCTCGAGATTATGTCCGTTGCTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020184.3-1414s21c1
Sequence:CCGGAGACTATCACTCGCTTCTATACTCGAGTATAGAAGCGAGTGATAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020184.3-646s21c1
Sequence:CCGGGGCTGCACATTCTCCTAATTACTCGAGTAATTAGGAGAATGTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020184
CNNM4 MISSION shRNA shRNA Plasmid DNA
cyclin M4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-904s1c1
Sequence:CCGGGCCCTATAATGACCTCGTGAACTCGAGTTCACGAGGTCATTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-844s1c1
Sequence:CCGGCCAGGAGATTCGCACTGTTTACTCGAGTAAACAGTGCGAATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-1099s1c1
Sequence:CCGGGCAGTCCAATATTGTAGATATCTCGAGATATCTACAATATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-2116s1c1
Sequence:CCGGCGAGACCACAACTCTTCTCAACTCGAGTTGAGAAGAGTTGTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-1966s1c1
Sequence:CCGGCGTGGACTTGCAGTACATCAACTCGAGTTGATGTACTGCAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020184.3-2810s21c1
Sequence:CCGGCCGGGAAGCAACGGACATAATCTCGAGATTATGTCCGTTGCTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020184.3-1414s21c1
Sequence:CCGGAGACTATCACTCGCTTCTATACTCGAGTATAGAAGCGAGTGATAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020184.3-646s21c1
Sequence:CCGGGGCTGCACATTCTCCTAATTACTCGAGTAATTAGGAGAATGTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020184
CNNM4 MISSION shRNA Lentiviral Transduction Particles
cyclin M4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-904s1c1
Sequence:CCGGGCCCTATAATGACCTCGTGAACTCGAGTTCACGAGGTCATTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-844s1c1
Sequence:CCGGCCAGGAGATTCGCACTGTTTACTCGAGTAAACAGTGCGAATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-1099s1c1
Sequence:CCGGGCAGTCCAATATTGTAGATATCTCGAGATATCTACAATATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-2116s1c1
Sequence:CCGGCGAGACCACAACTCTTCTCAACTCGAGTTGAGAAGAGTTGTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020184.2-1966s1c1
Sequence:CCGGCGTGGACTTGCAGTACATCAACTCGAGTTGATGTACTGCAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020184.3-2810s21c1
Sequence:CCGGCCGGGAAGCAACGGACATAATCTCGAGATTATGTCCGTTGCTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020184.3-1414s21c1
Sequence:CCGGAGACTATCACTCGCTTCTATACTCGAGTATAGAAGCGAGTGATAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020184.3-646s21c1
Sequence:CCGGGGCTGCACATTCTCCTAATTACTCGAGTAATTAGGAGAATGTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033570
VALIDATED
CNNM4 MISSION shRNA Bacterial Glycerol Stock
cyclin M4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000241901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033570.2-2192s21c1
Sequence:CCGGTCACGGACCTGCAGTACATTACTCGAGTAATGTACTGCAGGTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033570.2-4368s21c1
Sequence:CCGGATAGCAGATGACTCCTATTTACTCGAGTAAATAGGAGTCATCTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033570.2-1419s21c1
Sequence:CCGGCTACAACCACCCGGTACATTTCTCGAGAAATGTACCGGGTGGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033570.2-1122s21c1
Sequence:CCGGGAAGGTGACAGAGCCCTATAACTCGAGTTATAGGGCTCTGTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033570
VALIDATED
CNNM4 MISSION shRNA shRNA Plasmid DNA
cyclin M4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000241901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033570.2-2192s21c1
Sequence:CCGGTCACGGACCTGCAGTACATTACTCGAGTAATGTACTGCAGGTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033570.2-4368s21c1
Sequence:CCGGATAGCAGATGACTCCTATTTACTCGAGTAAATAGGAGTCATCTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033570.2-1419s21c1
Sequence:CCGGCTACAACCACCCGGTACATTTCTCGAGAAATGTACCGGGTGGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033570.2-1122s21c1
Sequence:CCGGGAAGGTGACAGAGCCCTATAACTCGAGTTATAGGGCTCTGTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033570
VALIDATED
CNNM4 MISSION shRNA Lentiviral Transduction Particles
cyclin M4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000241901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033570.2-2192s21c1
Sequence:CCGGTCACGGACCTGCAGTACATTACTCGAGTAATGTACTGCAGGTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033570.2-4368s21c1
Sequence:CCGGATAGCAGATGACTCCTATTTACTCGAGTAAATAGGAGTCATCTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033570.2-1419s21c1
Sequence:CCGGCTACAACCACCCGGTACATTTCTCGAGAAATGTACCGGGTGGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033570.2-1122s21c1
Sequence:CCGGGAAGGTGACAGAGCCCTATAACTCGAGTTATAGGGCTCTGTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks