EMAIL THIS PAGE TO A FRIEND

CNOT10

CCR4-NOT transcription complex, subunit 10

Gene ID:
Mouse(78893) CCR4-NOT transcription complex, subunit 10
Rat(316034) CCR4-NOT transcription complex, subunit 10
Zebrafish(449918) CCR4-NOT transcription complex, subunit 10
dog(612778) CCR4-NOT transcription complex, subunit 10
cow(540938) CCR4-NOT transcription complex, subunit 10
Horse(100050817) CCR4-NOT transcription complex, subunit 10
domestic cat(101092785) CCR4-NOT transcription complex, subunit 10
chicken(420669) CCR4-NOT transcription complex, subunit 10
domestic guinea pig(100721627) CCR4-NOT transcription complex, subunit 10
naked mole-rat(101711354) CCR4-NOT transcription complex, subunit 10
sheep(101105110) CCR4-NOT transcription complex, subunit 10
Domestic Rabbit(100347070) CCR4-NOT transcription complex, subunit 10
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015442 Rosetta Predictions human pricing
NM_001007003 Rosetta Predictions rat pricing
NM_153585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093398 predicted 864
2 SASI_Hs01_00093399 predicted 837
3 SASI_Hs01_00093400 predicted 1379
4 SASI_Hs01_00093403 predicted 330
5 SASI_Hs01_00093404 predicted 908
6 SASI_Hs01_00093407 predicted 2448
7 SASI_Hs02_00347828 predicted 2114
8 SASI_Hs02_00347829 predicted 2208
9 SASI_Hs02_00347830 predicted 1335
10 SASI_Hs02_00347831 predicted 1919
11 SASI_Hs01_00093401 predicted 961
12 SASI_Hs01_00093402 predicted 1910
13 SASI_Hs01_00093405 predicted 2315
14 SASI_Hs01_00093406 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052349 predicted 1840
2 SASI_Rn01_00052350 predicted 1238
3 SASI_Rn01_00052351 predicted 536
4 SASI_Rn01_00052352 predicted 1984
5 SASI_Rn01_00052353 predicted 1658
6 SASI_Rn01_00052354 predicted 2330
7 SASI_Rn01_00052355 predicted 1328
8 SASI_Rn01_00052356 predicted 996
9 SASI_Rn01_00052357 predicted 469
10 SASI_Rn01_00052358 predicted 1440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199835 predicted 1385
2 SASI_Mm01_00199837 predicted 995
3 SASI_Mm01_00199838 predicted 1019
4 SASI_Mm01_00199839 predicted 1000
5 SASI_Mm01_00199841 predicted 1332
6 SASI_Mm01_00199843 predicted 544
7 SASI_Mm01_00199844 predicted 2134
8 SASI_Mm02_00343401 predicted 1395
9 SASI_Mm02_00343402 predicted 731
10 SASI_Mm02_00343403 predicted 1639
11 SASI_Mm01_00199836 predicted 848
12 SASI_Mm01_00199840 predicted 452
13 SASI_Mm01_00199842 predicted 1892
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015442
VALIDATED
CNOT10 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 10
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015442.1-2007s1c1
Sequence:CCGGCGACAGAATATCTGATGCCATCTCGAGATGGCATCAGATATTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015442.1-2226s1c1
Sequence:CCGGCGAATATGACAAAGCCCGAAACTCGAGTTTCGGGCTTTGTCATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-913s1c1
Sequence:CCGGCAGTACAAAGTACGAGCTTATCTCGAGATAAGCTCGTACTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2263s1c1
Sequence:CCGGGCTTCAATGATCCATCCTAAACTCGAGTTTAGGATGGATCATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-1175s1c1
Sequence:CCGGGCAAGCACAATTTGGGAATATCTCGAGATATTCCCAAATTGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015442.1-2576s1c1
Sequence:CCGGGATGGTGAAGGCTGTTAATTTCTCGAGAAATTAACAGCCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2553s1c1
Sequence:CCGGGTATCACAGCAGAATGAATAACTCGAGTTATTCATTCTGCTGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2550s1c1
Sequence:CCGGGTTGTATCACAGCAGAATGAACTCGAGTTCATTCTGCTGTGATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-868s21c1
Sequence:CCGGGCTGAAAGTGGAGCTCTAATACTCGAGTATTAGAGCTCCACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-581s21c1
Sequence:CCGGACAGCATGTTGTACTATAATCCTCGAGGATTATAGTACAACATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1531s21c1
Sequence:CCGGGGTCAAGGCTATCATCGTAAACTCGAGTTTACGATGATAGCCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-846s21c1
Sequence:CCGGCAAAGATGGATCTAATCATAACTCGAGTTATGATTAGATCCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1032s21c1
Sequence:CCGGTGAGTACTTAAGAGGTAATTACTCGAGTAATTACCTCTTAAGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1146s21c1
Sequence:CCGGTAACCTTGGTTGCATCCATTTCTCGAGAAATGGATGCAACCAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-2212s21c1
Sequence:CCGGTACTGCCTGAGGAGCGAATATCTCGAGATATTCGCTCCTCAGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015442
VALIDATED
CNOT10 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 10
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015442.1-2007s1c1
Sequence:CCGGCGACAGAATATCTGATGCCATCTCGAGATGGCATCAGATATTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015442.1-2226s1c1
Sequence:CCGGCGAATATGACAAAGCCCGAAACTCGAGTTTCGGGCTTTGTCATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-913s1c1
Sequence:CCGGCAGTACAAAGTACGAGCTTATCTCGAGATAAGCTCGTACTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2263s1c1
Sequence:CCGGGCTTCAATGATCCATCCTAAACTCGAGTTTAGGATGGATCATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-1175s1c1
Sequence:CCGGGCAAGCACAATTTGGGAATATCTCGAGATATTCCCAAATTGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015442.1-2576s1c1
Sequence:CCGGGATGGTGAAGGCTGTTAATTTCTCGAGAAATTAACAGCCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2553s1c1
Sequence:CCGGGTATCACAGCAGAATGAATAACTCGAGTTATTCATTCTGCTGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2550s1c1
Sequence:CCGGGTTGTATCACAGCAGAATGAACTCGAGTTCATTCTGCTGTGATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-868s21c1
Sequence:CCGGGCTGAAAGTGGAGCTCTAATACTCGAGTATTAGAGCTCCACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-581s21c1
Sequence:CCGGACAGCATGTTGTACTATAATCCTCGAGGATTATAGTACAACATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1531s21c1
Sequence:CCGGGGTCAAGGCTATCATCGTAAACTCGAGTTTACGATGATAGCCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-846s21c1
Sequence:CCGGCAAAGATGGATCTAATCATAACTCGAGTTATGATTAGATCCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1032s21c1
Sequence:CCGGTGAGTACTTAAGAGGTAATTACTCGAGTAATTACCTCTTAAGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1146s21c1
Sequence:CCGGTAACCTTGGTTGCATCCATTTCTCGAGAAATGGATGCAACCAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-2212s21c1
Sequence:CCGGTACTGCCTGAGGAGCGAATATCTCGAGATATTCGCTCCTCAGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015442
VALIDATED
CNOT10 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 10
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015442.1-2007s1c1
Sequence:CCGGCGACAGAATATCTGATGCCATCTCGAGATGGCATCAGATATTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015442.1-2226s1c1
Sequence:CCGGCGAATATGACAAAGCCCGAAACTCGAGTTTCGGGCTTTGTCATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-913s1c1
Sequence:CCGGCAGTACAAAGTACGAGCTTATCTCGAGATAAGCTCGTACTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2263s1c1
Sequence:CCGGGCTTCAATGATCCATCCTAAACTCGAGTTTAGGATGGATCATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-1175s1c1
Sequence:CCGGGCAAGCACAATTTGGGAATATCTCGAGATATTCCCAAATTGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015442.1-2576s1c1
Sequence:CCGGGATGGTGAAGGCTGTTAATTTCTCGAGAAATTAACAGCCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2553s1c1
Sequence:CCGGGTATCACAGCAGAATGAATAACTCGAGTTATTCATTCTGCTGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015442.1-2550s1c1
Sequence:CCGGGTTGTATCACAGCAGAATGAACTCGAGTTCATTCTGCTGTGATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-868s21c1
Sequence:CCGGGCTGAAAGTGGAGCTCTAATACTCGAGTATTAGAGCTCCACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-581s21c1
Sequence:CCGGACAGCATGTTGTACTATAATCCTCGAGGATTATAGTACAACATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1531s21c1
Sequence:CCGGGGTCAAGGCTATCATCGTAAACTCGAGTTTACGATGATAGCCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-846s21c1
Sequence:CCGGCAAAGATGGATCTAATCATAACTCGAGTTATGATTAGATCCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1032s21c1
Sequence:CCGGTGAGTACTTAAGAGGTAATTACTCGAGTAATTACCTCTTAAGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-1146s21c1
Sequence:CCGGTAACCTTGGTTGCATCCATTTCTCGAGAAATGGATGCAACCAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015442.1-2212s21c1
Sequence:CCGGTACTGCCTGAGGAGCGAATATCTCGAGATATTCGCTCCTCAGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153585
VALIDATED
CNOT10 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1824s1c1
Sequence:CCGGCAAGCTGTCTGGCTCTCTTAACTCGAGTTAAGAGAGCCAGACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1401s1c1
Sequence:CCGGGTCTATTGTTGGTCAGGGATACTCGAGTATCCCTGACCAACAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1255s1c1
Sequence:CCGGGCCTTCGAGTGTCTGATTGAACTCGAGTTCAATCAGACACTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-283s21c1
Sequence:CCGGTTGCCTGTCTCCAAGATATAACTCGAGTTATATCTTGGAGACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1326s21c1
Sequence:CCGGTGCTGCATTGCTGCCAATAAACTCGAGTTTATTGGCAGCAATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1410s21c1
Sequence:CCGGGGTCAGGGATATCACCGTAAACTCGAGTTTACGGTGATATCCCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1760s21c1
Sequence:CCGGGGCTCTGGCCTTAGGTGATAACTCGAGTTATCACCTAAGGCCAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-2593s21c1
Sequence:CCGGAGCACTCAAGACTGTTATAAACTCGAGTTTATAACAGTCTTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153585
VALIDATED
CNOT10 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1824s1c1
Sequence:CCGGCAAGCTGTCTGGCTCTCTTAACTCGAGTTAAGAGAGCCAGACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1401s1c1
Sequence:CCGGGTCTATTGTTGGTCAGGGATACTCGAGTATCCCTGACCAACAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1255s1c1
Sequence:CCGGGCCTTCGAGTGTCTGATTGAACTCGAGTTCAATCAGACACTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-283s21c1
Sequence:CCGGTTGCCTGTCTCCAAGATATAACTCGAGTTATATCTTGGAGACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1326s21c1
Sequence:CCGGTGCTGCATTGCTGCCAATAAACTCGAGTTTATTGGCAGCAATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1410s21c1
Sequence:CCGGGGTCAGGGATATCACCGTAAACTCGAGTTTACGGTGATATCCCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1760s21c1
Sequence:CCGGGGCTCTGGCCTTAGGTGATAACTCGAGTTATCACCTAAGGCCAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-2593s21c1
Sequence:CCGGAGCACTCAAGACTGTTATAAACTCGAGTTTATAACAGTCTTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153585
VALIDATED
CNOT10 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1824s1c1
Sequence:CCGGCAAGCTGTCTGGCTCTCTTAACTCGAGTTAAGAGAGCCAGACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1401s1c1
Sequence:CCGGGTCTATTGTTGGTCAGGGATACTCGAGTATCCCTGACCAACAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153585.3-1255s1c1
Sequence:CCGGGCCTTCGAGTGTCTGATTGAACTCGAGTTCAATCAGACACTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-283s21c1
Sequence:CCGGTTGCCTGTCTCCAAGATATAACTCGAGTTATATCTTGGAGACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1326s21c1
Sequence:CCGGTGCTGCATTGCTGCCAATAAACTCGAGTTTATTGGCAGCAATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1410s21c1
Sequence:CCGGGGTCAGGGATATCACCGTAAACTCGAGTTTACGGTGATATCCCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-1760s21c1
Sequence:CCGGGGCTCTGGCCTTAGGTGATAACTCGAGTTATCACCTAAGGCCAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153585.4-2593s21c1
Sequence:CCGGAGCACTCAAGACTGTTATAAACTCGAGTTTATAACAGTCTTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks