EMAIL THIS PAGE TO A FRIEND

CNOT11

CCR4-NOT transcription complex, subunit 11

56 Gene Product Result for
Synonyms: C2orf29
UniProtKB ID: Q9UKZ1, Q6P2M9, Q8N681
Gene ID:
Mouse(52846) CCR4-NOT transcription complex, subunit 11
Rat(363221) CCR4-NOT transcription complex, subunit 11
Zebrafish(336124) CCR4-NOT transcription complex, subunit 11
dog(481334) CCR4-NOT transcription complex, subunit 11
cow(506268) CCR4-NOT transcription complex, subunit 11
naked mole-rat(101706341) CCR4-NOT transcription complex, subunit 11
domestic guinea pig(100730278) CCR4-NOT transcription complex, subunit 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017546 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017546 Rosetta Predictions human pricing
NM_001108794 Rosetta Predictions rat pricing
NM_028043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084934 predicted 1249
2 SASI_Hs02_00350177 predicted 1574
3 SASI_Hs01_00084935 predicted 1511
4 SASI_Hs01_00084936 predicted 1500
5 SASI_Hs01_00084937 predicted 1288
6 SASI_Hs02_00350178 predicted 1204
7 SASI_Hs01_00084938 predicted 1282
8 SASI_Hs02_00350179 predicted 1109
9 SASI_Hs01_00084942 predicted 1617
10 SASI_Hs01_00084943 predicted 1357
11 SASI_Hs01_00084939 predicted 1618
12 SASI_Hs01_00084940 predicted 1354
13 SASI_Hs01_00084941 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242135 predicted 1110
2 SASI_Rn02_00242136 predicted 1110
3 SASI_Rn02_00242137 predicted 1486
4 SASI_Rn02_00242138 predicted 1361
5 SASI_Rn02_00242139 predicted 971
6 SASI_Rn02_00242140 predicted 1250
7 SASI_Rn02_00242141 predicted 1221
8 SASI_Rn02_00242142 predicted 700
9 SASI_Rn02_00242143 predicted 1327
10 SASI_Rn02_00242144 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180217 predicted 670
2 SASI_Mm01_00180218 predicted 1080
3 SASI_Mm02_00333217 predicted 634
4 SASI_Mm01_00180219 predicted 1077
5 SASI_Mm01_00180220 predicted 1446
6 SASI_Mm01_00180221 predicted 1449
7 SASI_Mm01_00180223 predicted 959
8 SASI_Mm01_00180224 predicted 1556
9 SASI_Mm01_00180225 predicted 1244
10 SASI_Mm01_00180226 predicted 1296
11 SASI_Mm01_00180222 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017546
CNOT11 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017546.4-1200s21c1
Sequence:CCGGACAACCCTTTAGTCGCTATAGCTCGAGCTATAGCGACTAAAGGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017546.4-1050s21c1
Sequence:CCGGGTGTGGAGATCAAACGAATAACTCGAGTTATTCGTTTGATCTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017546.3-2213s1c1
Sequence:CCGGGCTTCTATTACCAGGCTGTAACTCGAGTTACAGCCTGGTAATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017546.3-920s1c1
Sequence:CCGGCTCCACATTTGTGAGGATGAACTCGAGTTCATCCTCACAAATGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-734s1c1
Sequence:CCGGCAATCTGAATTGCCAACGCAACTCGAGTTGCGTTGGCAATTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017546.3-1417s1c1
Sequence:CCGGCCAATCCTTGATCCGTAACAACTCGAGTTGTTACGGATCAAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-1459s1c1
Sequence:CCGGGTTTATAGAAGTGCAGGCATTCTCGAGAATGCCTGCACTTCTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-789s1c1
Sequence:CCGGCAGACCCGGATTCTTCTAATTCTCGAGAATTAGAAGAATCCGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017546.3-2020s1c1
Sequence:CCGGGCAAACAAACAGGAGTTTGTTCTCGAGAACAAACTCCTGTTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017546.3-1970s1c1
Sequence:CCGGGCATTTGTCCTAGAGGTGAAACTCGAGTTTCACCTCTAGGACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017546
CNOT11 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017546.4-1200s21c1
Sequence:CCGGACAACCCTTTAGTCGCTATAGCTCGAGCTATAGCGACTAAAGGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017546.4-1050s21c1
Sequence:CCGGGTGTGGAGATCAAACGAATAACTCGAGTTATTCGTTTGATCTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017546.3-2213s1c1
Sequence:CCGGGCTTCTATTACCAGGCTGTAACTCGAGTTACAGCCTGGTAATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017546.3-920s1c1
Sequence:CCGGCTCCACATTTGTGAGGATGAACTCGAGTTCATCCTCACAAATGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-734s1c1
Sequence:CCGGCAATCTGAATTGCCAACGCAACTCGAGTTGCGTTGGCAATTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017546.3-1417s1c1
Sequence:CCGGCCAATCCTTGATCCGTAACAACTCGAGTTGTTACGGATCAAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-1459s1c1
Sequence:CCGGGTTTATAGAAGTGCAGGCATTCTCGAGAATGCCTGCACTTCTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-789s1c1
Sequence:CCGGCAGACCCGGATTCTTCTAATTCTCGAGAATTAGAAGAATCCGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017546.3-2020s1c1
Sequence:CCGGGCAAACAAACAGGAGTTTGTTCTCGAGAACAAACTCCTGTTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017546.3-1970s1c1
Sequence:CCGGGCATTTGTCCTAGAGGTGAAACTCGAGTTTCACCTCTAGGACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017546
CNOT11 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017546.4-1200s21c1
Sequence:CCGGACAACCCTTTAGTCGCTATAGCTCGAGCTATAGCGACTAAAGGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017546.4-1050s21c1
Sequence:CCGGGTGTGGAGATCAAACGAATAACTCGAGTTATTCGTTTGATCTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017546.3-2213s1c1
Sequence:CCGGGCTTCTATTACCAGGCTGTAACTCGAGTTACAGCCTGGTAATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017546.3-920s1c1
Sequence:CCGGCTCCACATTTGTGAGGATGAACTCGAGTTCATCCTCACAAATGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-734s1c1
Sequence:CCGGCAATCTGAATTGCCAACGCAACTCGAGTTGCGTTGGCAATTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017546.3-1417s1c1
Sequence:CCGGCCAATCCTTGATCCGTAACAACTCGAGTTGTTACGGATCAAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-1459s1c1
Sequence:CCGGGTTTATAGAAGTGCAGGCATTCTCGAGAATGCCTGCACTTCTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017546.3-789s1c1
Sequence:CCGGCAGACCCGGATTCTTCTAATTCTCGAGAATTAGAAGAATCCGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017546.3-2020s1c1
Sequence:CCGGGCAAACAAACAGGAGTTTGTTCTCGAGAACAAACTCCTGTTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017546.3-1970s1c1
Sequence:CCGGGCATTTGTCCTAGAGGTGAAACTCGAGTTTCACCTCTAGGACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028043
VALIDATED
CNOT11 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028043.2-2411s1c1
Sequence:CCGGGATATCTCTAGAACCGATTTACTCGAGTAAATCGGTTCTAGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1083s21c1
Sequence:CCGGCCAAACTTGTTTATCACATTGCTCGAGCAATGTGATAAACAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1185s21c1
Sequence:CCGGCAAGCCAGATCACGGAGTATTCTCGAGAATACTCCGTGATCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028043.2-2412s21c1
Sequence:CCGGATATCTCTAGAACCGATTTATCTCGAGATAAATCGGTTCTAGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-806s21c1
Sequence:CCGGTCTCGGATCACAGAGTCTTTACTCGAGTAAAGACTCTGTGATCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1140s21c1
Sequence:CCGGACAACCCTTTAGTCGCTATAGCTCGAGCTATAGCGACTAAAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-963s1c1
Sequence:CCGGGATCGATGTGTGTGAAGAATACTCGAGTATTCTTCACACACATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-1523s1c1
Sequence:CCGGGAAACGCCTTCAGAGACCAAACTCGAGTTTGGTCTCTGAAGGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-1460s1c1
Sequence:CCGGGAATTTAGTAGGATACGGGAACTCGAGTTCCCGTATCCTACTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028043
VALIDATED
CNOT11 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028043.2-2411s1c1
Sequence:CCGGGATATCTCTAGAACCGATTTACTCGAGTAAATCGGTTCTAGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1083s21c1
Sequence:CCGGCCAAACTTGTTTATCACATTGCTCGAGCAATGTGATAAACAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1185s21c1
Sequence:CCGGCAAGCCAGATCACGGAGTATTCTCGAGAATACTCCGTGATCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028043.2-2412s21c1
Sequence:CCGGATATCTCTAGAACCGATTTATCTCGAGATAAATCGGTTCTAGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-806s21c1
Sequence:CCGGTCTCGGATCACAGAGTCTTTACTCGAGTAAAGACTCTGTGATCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1140s21c1
Sequence:CCGGACAACCCTTTAGTCGCTATAGCTCGAGCTATAGCGACTAAAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-963s1c1
Sequence:CCGGGATCGATGTGTGTGAAGAATACTCGAGTATTCTTCACACACATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-1523s1c1
Sequence:CCGGGAAACGCCTTCAGAGACCAAACTCGAGTTTGGTCTCTGAAGGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-1460s1c1
Sequence:CCGGGAATTTAGTAGGATACGGGAACTCGAGTTCCCGTATCCTACTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028043
VALIDATED
CNOT11 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028043.2-2411s1c1
Sequence:CCGGGATATCTCTAGAACCGATTTACTCGAGTAAATCGGTTCTAGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1083s21c1
Sequence:CCGGCCAAACTTGTTTATCACATTGCTCGAGCAATGTGATAAACAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1185s21c1
Sequence:CCGGCAAGCCAGATCACGGAGTATTCTCGAGAATACTCCGTGATCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028043.2-2412s21c1
Sequence:CCGGATATCTCTAGAACCGATTTATCTCGAGATAAATCGGTTCTAGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-806s21c1
Sequence:CCGGTCTCGGATCACAGAGTCTTTACTCGAGTAAAGACTCTGTGATCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028043.2-1140s21c1
Sequence:CCGGACAACCCTTTAGTCGCTATAGCTCGAGCTATAGCGACTAAAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-963s1c1
Sequence:CCGGGATCGATGTGTGTGAAGAATACTCGAGTATTCTTCACACACATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-1523s1c1
Sequence:CCGGGAAACGCCTTCAGAGACCAAACTCGAGTTTGGTCTCTGAAGGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028043.2-1460s1c1
Sequence:CCGGGAATTTAGTAGGATACGGGAACTCGAGTTCCCGTATCCTACTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks