EMAIL THIS PAGE TO A FRIEND

CNOT1

CCR4-NOT transcription complex, subunit 1

257 Gene Product Result for
Synonyms: CDC39 NOT1 NOT1H
Gene ID:
Mouse(234594) CCR4-NOT transcription complex, subunit 1
Rat(291841) CCR4-NOT transcription complex, subunit 1
sheep(101105519) CCR4-NOT transcription complex, subunit 1
naked mole-rat(101713904) CCR4-NOT transcription complex, subunit 1
domestic guinea pig(100712839) CCR4-NOT transcription complex, subunit 1
Zebrafish(448949) CCR4-NOT transcription complex, subunit 1
chicken(100858397) CCR4-NOT transcription complex subunit 1-like
cow(533968) CCR4-NOT transcription complex, subunit 1
Horse(100052554) CCR4-NOT transcription complex, subunit 1
domestic cat(101089665) CCR4-NOT transcription complex, subunit 1
dog(608777) CCR4-NOT transcription complex, subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0076 AQUA Peptide SPVTFLSDL[R] chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016284 Rosetta Predictions human pricing
NM_206999 Rosetta Predictions human pricing
NM_001134840 Rosetta Predictions rat pricing
XM_001056829 Rosetta Predictions rat pricing
NM_153164 Rosetta Predictions mouse pricing
NM_178078 Rosetta Predictions mouse pricing
XM_001003604 Rosetta Predictions mouse pricing
XM_001003611 Rosetta Predictions mouse pricing
XM_894673 Rosetta Predictions mouse pricing
XM_901788 Rosetta Predictions mouse pricing
XM_901793 Rosetta Predictions mouse pricing
XM_901801 Rosetta Predictions mouse pricing
XM_901805 Rosetta Predictions mouse pricing
XM_901808 Rosetta Predictions mouse pricing
XM_901816 Rosetta Predictions mouse pricing
XM_901818 Rosetta Predictions mouse pricing
XM_901826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151572 predicted 2417
2 SASI_Hs02_00349200 predicted 3914
3 SASI_Hs01_00151573 predicted 2313
4 SASI_Hs01_00151574 predicted 3686
5 SASI_Hs01_00151575 predicted 2734
6 SASI_Hs01_00151577 predicted 4150
7 SASI_Hs02_00349201 predicted 4321
8 SASI_Hs02_00349202 predicted 1896
9 SASI_Hs02_00349203 predicted 4262
10 SASI_Hs02_00349204 predicted 2342
11 SASI_Hs01_00151576 predicted 2437
12 SASI_Hs01_00151578 predicted 1684
13 SASI_Hs01_00151579 predicted 3224
14 SASI_Hs01_00151580 predicted 1986
15 SASI_Hs01_00151581 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020172 predicted 2419
2 SASI_Hs02_00373693 predicted 3918
3 SASI_Hs01_00020173 predicted 2312
4 SASI_Hs01_00020174 predicted 3684
5 SASI_Hs01_00020175 predicted 2733
6 SASI_Hs01_00020177 predicted 4143
7 SASI_Hs02_00373694 predicted 4319
8 SASI_Hs02_00373695 predicted 1890
9 SASI_Hs02_00373696 predicted 4266
10 SASI_Hs02_00373697 predicted 2341
11 SASI_Hs01_00020176 predicted 2440
12 SASI_Hs01_00020178 predicted 1683
13 SASI_Hs01_00020179 predicted 3225
14 SASI_Hs01_00020180 predicted 1985
15 SASI_Hs01_00020181 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258664 predicted 5956
2 SASI_Rn02_00258665 predicted 2076
3 SASI_Rn02_00258666 predicted 3032
4 SASI_Rn02_00258667 predicted 2319
5 SASI_Rn02_00258668 predicted 5525
6 SASI_Rn02_00258669 predicted 5110
7 SASI_Rn02_00258670 predicted 4079
8 SASI_Rn02_00258671 predicted 2736
9 SASI_Rn02_00258672 predicted 5234
10 SASI_Rn02_00258673 predicted 3520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284580 predicted 5956
2 SASI_Rn02_00284581 predicted 2072
3 SASI_Rn02_00284582 predicted 3036
4 SASI_Rn02_00284583 predicted 2328
5 SASI_Rn02_00284584 predicted 5521
6 SASI_Rn02_00284585 predicted 5114
7 SASI_Rn02_00284586 predicted 4081
8 SASI_Rn02_00284587 predicted 2740
9 SASI_Rn02_00284588 predicted 5234
10 SASI_Rn02_00284589 predicted 3511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343064 predicted 1198
2 SASI_Mm02_00343065 predicted 4678
3 SASI_Mm02_00343066 predicted 2327
4 SASI_Mm02_00343067 predicted 5227
5 SASI_Mm02_00343068 predicted 1624
6 SASI_Mm02_00343069 predicted 1461
7 SASI_Mm02_00343070 predicted 1581
8 SASI_Mm02_00343071 predicted 5440
9 SASI_Mm02_00343072 predicted 3718
10 SASI_Mm02_00343073 predicted 7086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348530 predicted 1198
2 SASI_Mm02_00348531 predicted 4669
3 SASI_Mm02_00348532 predicted 2322
4 SASI_Mm02_00348533 predicted 5217
5 SASI_Mm02_00348534 predicted 1625
6 SASI_Mm02_00348535 predicted 1463
7 SASI_Mm02_00348536 predicted 1586
8 SASI_Mm02_00348537 predicted 5421
9 SASI_Mm02_00348538 predicted 3710
10 SASI_Mm02_00348539 predicted 7069
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259468 predicted 6196
2 SASI_Mm01_00259469 predicted 4618
3 SASI_Mm01_00259470 predicted 6174
4 SASI_Mm01_00259471 predicted 5884
5 SASI_Mm01_00259472 predicted 5726
6 SASI_Mm01_00259473 predicted 4797
7 SASI_Mm01_00259474 predicted 5852
8 SASI_Mm01_00259475 predicted 5789
9 SASI_Mm01_00259476 predicted 5591
10 SASI_Mm01_00259477 predicted 6127
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272690 predicted 6203
2 SASI_Mm01_00272691 predicted 4620
3 SASI_Mm01_00272692 predicted 6177
4 SASI_Mm01_00272693 predicted 5895
5 SASI_Mm01_00272694 predicted 5732
6 SASI_Mm01_00272695 predicted 4805
7 SASI_Mm01_00272696 predicted 5856
8 SASI_Mm01_00272697 predicted 5794
9 SASI_Mm01_00272698 predicted 5600
10 SASI_Mm01_00272699 predicted 6132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224337 predicted 6268
2 SASI_Mm01_00224338 predicted 4680
3 SASI_Mm01_00224339 predicted 6241
4 SASI_Mm01_00224340 predicted 5958
5 SASI_Mm01_00224341 predicted 5801
6 SASI_Mm01_00224342 predicted 4863
7 SASI_Mm01_00224343 predicted 5922
8 SASI_Mm01_00224344 predicted 5857
9 SASI_Mm01_00224345 predicted 5664
10 SASI_Mm01_00224346 predicted 6189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279588 predicted 4684
2 SASI_Mm01_00279589 predicted 4925
3 SASI_Mm01_00279590 predicted 5964
4 SASI_Mm01_00279591 predicted 5634
5 SASI_Mm01_00279592 predicted 5798
6 SASI_Mm01_00279593 predicted 4874
7 SASI_Mm01_00279594 predicted 5929
8 SASI_Mm01_00279595 predicted 5868
9 SASI_Mm01_00279596 predicted 5673
10 SASI_Mm01_00279597 predicted 5654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279208 predicted 1756
2 SASI_Mm01_00279209 predicted 500
3 SASI_Mm01_00279210 predicted 1202
4 SASI_Mm01_00279211 predicted 1428
5 SASI_Mm01_00279212 predicted 394
6 SASI_Mm01_00279213 predicted 1639
7 SASI_Mm01_00279214 predicted 1695
8 SASI_Mm01_00279215 predicted 1464
9 SASI_Mm01_00279216 predicted 1589
10 SASI_Mm01_00279217 predicted 1942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265362 predicted 6261
2 SASI_Mm01_00265363 predicted 4683
3 SASI_Mm01_00265364 predicted 6244
4 SASI_Mm01_00265365 predicted 5956
5 SASI_Mm01_00265366 predicted 5803
6 SASI_Mm01_00265367 predicted 4866
7 SASI_Mm01_00265368 predicted 5931
8 SASI_Mm01_00265369 predicted 5862
9 SASI_Mm01_00265370 predicted 5663
10 SASI_Mm01_00265371 predicted 6191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281590 predicted 2754
2 SASI_Mm01_00281591 predicted 3832
3 SASI_Mm01_00281592 predicted 1199
4 SASI_Mm01_00281593 predicted 2331
5 SASI_Mm01_00281594 predicted 2408
6 SASI_Mm01_00281595 predicted 2750
7 SASI_Mm01_00281596 predicted 3654
8 SASI_Mm01_00281597 predicted 1466
9 SASI_Mm01_00281598 predicted 2703
10 SASI_Mm01_00281599 predicted 3725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250693 predicted 5931
2 SASI_Mm01_00250694 predicted 1202
3 SASI_Mm01_00250695 predicted 4166
4 SASI_Mm01_00250696 predicted 2332
5 SASI_Mm01_00250697 predicted 2747
6 SASI_Mm01_00250698 predicted 1471
7 SASI_Mm01_00250699 predicted 6014
8 SASI_Mm01_00250700 predicted 5447
9 SASI_Mm01_00250701 predicted 3730
10 SASI_Mm01_00250702 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227643 predicted 1533
2 SASI_Mm01_00227644 predicted 1609
3 SASI_Mm01_00227645 predicted 1514
4 SASI_Mm01_00227646 predicted 1231
5 SASI_Mm01_00227647 predicted 900
6 SASI_Mm01_00227648 predicted 1069
7 SASI_Mm01_00227649 predicted 2549
8 SASI_Mm01_00227650 predicted 1031
9 SASI_Mm01_00227651 predicted 1189
10 SASI_Mm01_00227652 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239064 predicted 3137
2 SASI_Mm01_00239065 predicted 1556
3 SASI_Mm01_00239066 predicted 3105
4 SASI_Mm01_00239067 predicted 2822
5 SASI_Mm01_00239068 predicted 2671
6 SASI_Mm01_00239069 predicted 1739
7 SASI_Mm01_00239070 predicted 2787
8 SASI_Mm01_00239071 predicted 2729
9 SASI_Mm01_00239072 predicted 2539
10 SASI_Mm01_00239073 predicted 3058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283363 predicted 6288
2 SASI_Mm01_00283364 predicted 4690
3 SASI_Mm01_00283365 predicted 6266
4 SASI_Mm01_00283366 predicted 4924
5 SASI_Mm01_00283367 predicted 5625
6 SASI_Mm01_00283368 predicted 7301
7 SASI_Mm01_00283369 predicted 4874
8 SASI_Mm01_00283370 predicted 5670
9 SASI_Mm01_00283371 predicted 6216
10 SASI_Mm01_00283372 predicted 5655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016284
VALIDATED
CNOT1 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016284.3-2840s21c1
Sequence:CCGGCAGCTATTTCCAGCGAATATACTCGAGTATATTCGCTGGAAATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-1517s21c1
Sequence:CCGGCATTCAACATTCCCTTATAAACTCGAGTTTATAAGGGAATGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-3036s21c1
Sequence:CCGGTGCCTATTTGGTGGTATAATTCTCGAGAATTATACCACCAAATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-1956s21c1
Sequence:CCGGGCCAAATTGTCTCGAATACTTCTCGAGAAGTATTCGAGACAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-5732s1c1
Sequence:CCGGGCGATCCAACTATGAAGCAATCTCGAGATTGCTTCATAGTTGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-6657s1c1
Sequence:CCGGCCACCTAATTGTATCCAGTTACTCGAGTAACTGGATACAATTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-1956s1c1
Sequence:CCGGGCCAAATTGTCTCGAATACTTCTCGAGAAGTATTCGAGACAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016284.3-7293s1c1
Sequence:CCGGGCGTTTAAGTTCTGGAACCATCTCGAGATGGTTCCAGAACTTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016284.3-7426s1c1
Sequence:CCGGCGAAACTGCATCTCTGTTGTACTCGAGTACAACAGAGATGCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016284
VALIDATED
CNOT1 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016284.3-2840s21c1
Sequence:CCGGCAGCTATTTCCAGCGAATATACTCGAGTATATTCGCTGGAAATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-1517s21c1
Sequence:CCGGCATTCAACATTCCCTTATAAACTCGAGTTTATAAGGGAATGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-3036s21c1
Sequence:CCGGTGCCTATTTGGTGGTATAATTCTCGAGAATTATACCACCAAATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-1956s21c1
Sequence:CCGGGCCAAATTGTCTCGAATACTTCTCGAGAAGTATTCGAGACAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-5732s1c1
Sequence:CCGGGCGATCCAACTATGAAGCAATCTCGAGATTGCTTCATAGTTGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-6657s1c1
Sequence:CCGGCCACCTAATTGTATCCAGTTACTCGAGTAACTGGATACAATTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-1956s1c1
Sequence:CCGGGCCAAATTGTCTCGAATACTTCTCGAGAAGTATTCGAGACAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016284.3-7293s1c1
Sequence:CCGGGCGTTTAAGTTCTGGAACCATCTCGAGATGGTTCCAGAACTTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016284.3-7426s1c1
Sequence:CCGGCGAAACTGCATCTCTGTTGTACTCGAGTACAACAGAGATGCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016284
VALIDATED
CNOT1 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016284.3-2840s21c1
Sequence:CCGGCAGCTATTTCCAGCGAATATACTCGAGTATATTCGCTGGAAATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-1517s21c1
Sequence:CCGGCATTCAACATTCCCTTATAAACTCGAGTTTATAAGGGAATGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-3036s21c1
Sequence:CCGGTGCCTATTTGGTGGTATAATTCTCGAGAATTATACCACCAAATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016284.3-1956s21c1
Sequence:CCGGGCCAAATTGTCTCGAATACTTCTCGAGAAGTATTCGAGACAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-5732s1c1
Sequence:CCGGGCGATCCAACTATGAAGCAATCTCGAGATTGCTTCATAGTTGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-6657s1c1
Sequence:CCGGCCACCTAATTGTATCCAGTTACTCGAGTAACTGGATACAATTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016284.3-1956s1c1
Sequence:CCGGGCCAAATTGTCTCGAATACTTCTCGAGAAGTATTCGAGACAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016284.3-7293s1c1
Sequence:CCGGGCGTTTAAGTTCTGGAACCATCTCGAGATGGTTCCAGAACTTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016284.3-7426s1c1
Sequence:CCGGCGAAACTGCATCTCTGTTGTACTCGAGTACAACAGAGATGCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153164
VALIDATED
CNOT1 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-3896s21c1
Sequence:CCGGTGGTTAGGAATGATCACATTACTCGAGTAATGTGATCATTCCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-8081s21c1
Sequence:CCGGATAAGGATCAGGATCGTAAATCTCGAGATTTACGATCCTGATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-2851s21c1
Sequence:CCGGCAGTTATTTCCAGCGAATATACTCGAGTATATTCGCTGGAAATAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-3966s21c1
Sequence:CCGGTGTTAGAGGCTTACGTTAAAGCTCGAGCTTTAACGTAAGCCTCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153164.2-4407s21c1
Sequence:CCGGCAGGCCTGGCACCTCATATTACTCGAGTAATATGAGGTGCCAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153164
VALIDATED
CNOT1 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-3896s21c1
Sequence:CCGGTGGTTAGGAATGATCACATTACTCGAGTAATGTGATCATTCCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-8081s21c1
Sequence:CCGGATAAGGATCAGGATCGTAAATCTCGAGATTTACGATCCTGATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-2851s21c1
Sequence:CCGGCAGTTATTTCCAGCGAATATACTCGAGTATATTCGCTGGAAATAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-3966s21c1
Sequence:CCGGTGTTAGAGGCTTACGTTAAAGCTCGAGCTTTAACGTAAGCCTCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153164.2-4407s21c1
Sequence:CCGGCAGGCCTGGCACCTCATATTACTCGAGTAATATGAGGTGCCAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153164
VALIDATED
CNOT1 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-3896s21c1
Sequence:CCGGTGGTTAGGAATGATCACATTACTCGAGTAATGTGATCATTCCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-8081s21c1
Sequence:CCGGATAAGGATCAGGATCGTAAATCTCGAGATTTACGATCCTGATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-2851s21c1
Sequence:CCGGCAGTTATTTCCAGCGAATATACTCGAGTATATTCGCTGGAAATAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153164.2-3966s21c1
Sequence:CCGGTGTTAGAGGCTTACGTTAAAGCTCGAGCTTTAACGTAAGCCTCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153164.2-4407s21c1
Sequence:CCGGCAGGCCTGGCACCTCATATTACTCGAGTAATATGAGGTGCCAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks