EMAIL THIS PAGE TO A FRIEND

CNOT2

CCR4-NOT transcription complex, subunit 2

182 Gene Product Result for
Synonyms: CDC36 NOT2 NOT2H
UniProtKB ID: Q9NZN8, Q9H3E0, Q9NSX5, Q9NWR6, Q9P028
Gene ID:
Human(4848) Summary: This gene encodes a subunit of the multi-component CCR4-NOT complex. The CCR4-NOT complex regulates mRNA synthesis and degradation and is also thought to be involved in mRNA splicing, transport and localization. The encoded protein interacts with histone deacetylases and functions as a repressor of polymerase II transcription. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(72068) CCR4-NOT transcription complex, subunit 2
Rat(299805) CCR4-NOT transcription complex, subunit 2
domestic guinea pig(100718705) CCR4-NOT transcription complex, subunit 2
naked mole-rat(101722403) CCR4-NOT transcription complex, subunit 2
sheep(101122772) CCR4-NOT transcription complex, subunit 2
Domestic Rabbit(100342367) CCR4-NOT transcription complex, subunit 2
chicken(417851) CCR4-NOT transcription complex, subunit 2
cow(533945) CCR4-NOT transcription complex, subunit 2
Horse(100062938) CCR4-NOT transcription complex, subunit 2
domestic cat(101100650) CCR4-NOT transcription complex, subunit 2
dog(474446) CCR4-NOT transcription complex, subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014515 Rosetta Predictions human pricing
NM_001011988 Rosetta Predictions rat pricing
XM_576225 Rosetta Predictions rat pricing
NM_001037846 Rosetta Predictions mouse pricing
NM_001037847 Rosetta Predictions mouse pricing
NM_001037848 Rosetta Predictions mouse pricing
NM_028082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155409 predicted 1342
2 SASI_Hs01_00155410 predicted 1977
3 SASI_Hs01_00155411 predicted 1246
4 SASI_Hs01_00155412 predicted 1705
5 SASI_Hs01_00155413 predicted 590
6 SASI_Hs01_00155416 predicted 1819
7 SASI_Hs01_00155417 predicted 1829
8 SASI_Hs01_00155418 predicted 1452
9 SASI_Hs02_00345790 predicted 1808
10 SASI_Hs02_00345791 predicted 1490
11 SASI_Hs01_00155414 predicted 618
12 SASI_Hs01_00155415 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089396 predicted 727
2 SASI_Rn01_00089397 predicted 625
3 SASI_Rn02_00200021 predicted 698
4 SASI_Rn01_00089399 predicted 1511
5 SASI_Rn01_00089400 predicted 428
6 SASI_Rn01_00089401 predicted 857
7 SASI_Rn01_00089402 predicted 375
8 SASI_Rn01_00089403 predicted 1327
9 SASI_Rn01_00089404 predicted 340
10 SASI_Rn01_00089405 predicted 1426
11 SASI_Rn01_00089398 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173887 predicted 773
2 SASI_Rn01_00173888 predicted 674
3 SASI_Rn01_00173889 predicted 753
4 SASI_Rn01_00173890 predicted 1325
5 SASI_Rn01_00173891 predicted 910
6 SASI_Rn01_00173892 predicted 958
7 SASI_Rn01_00173893 predicted 1105
8 SASI_Rn01_00173894 predicted 667
9 SASI_Rn01_00173895 predicted 912
10 SASI_Rn01_00173896 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063105 predicted 1459
2 SASI_Mm01_00063106 predicted 1263
3 SASI_Mm01_00063107 predicted 1032
4 SASI_Mm01_00063110 predicted 1673
5 SASI_Mm01_00063111 predicted 1163
6 SASI_Mm02_00289465 predicted 1369
7 SASI_Mm01_00063112 predicted 1436
8 SASI_Mm01_00063113 predicted 1285
9 SASI_Mm01_00063114 predicted 1737
10 SASI_Mm02_00289466 predicted 1440
11 SASI_Mm01_00063108 predicted 952
12 SASI_Mm01_00063109 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118372 predicted 1396
2 SASI_Mm01_00118373 predicted 1204
3 SASI_Mm01_00118374 predicted 970
4 SASI_Mm01_00118377 predicted 1608
5 SASI_Mm01_00118378 predicted 1102
6 SASI_Mm02_00289467 predicted 1315
7 SASI_Mm01_00118379 predicted 1375
8 SASI_Mm01_00118380 predicted 1225
9 SASI_Mm01_00118381 predicted 1677
10 SASI_Mm02_00289468 predicted 1379
11 SASI_Mm01_00118375 predicted 897
12 SASI_Mm01_00118376 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289469 predicted 804
2 SASI_Mm01_00076702 predicted 434
3 SASI_Mm01_00076703 predicted 693
4 SASI_Mm01_00076704 predicted 308
5 SASI_Mm01_00076705 predicted 327
6 SASI_Mm01_00076706 predicted 236
7 SASI_Mm01_00076707 predicted 366
8 SASI_Mm01_00076708 predicted 478
9 SASI_Mm01_00076709 predicted 302
10 SASI_Mm02_00289470 predicted 458
11 SASI_Mm01_00076701 predicted 773
12 SASI_Mm01_00076710 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103532 predicted 1269
2 SASI_Mm01_00103533 predicted 1081
3 SASI_Mm01_00103534 predicted 844
4 SASI_Mm01_00103537 predicted 1478
5 SASI_Mm01_00103538 predicted 972
6 SASI_Mm02_00333318 predicted 1181
7 SASI_Mm01_00103539 predicted 1248
8 SASI_Mm01_00103540 predicted 1100
9 SASI_Mm01_00103541 predicted 1542
10 SASI_Mm02_00333319 predicted 1246
11 SASI_Mm01_00103535 predicted 760
12 SASI_Mm01_00103536 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014515
VALIDATED
CNOT2 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-395s1c1
Sequence:CCGGCCTCAGTTAAATCGCAGCTTACTCGAGTAAGCTGCGATTTAACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-1513s1c1
Sequence:CCGGCCGTGATTGGAGATACCACAACTCGAGTTGTGGTATCTCCAATCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-881s1c1
Sequence:CCGGGCTCCTTATGTTGGAATGGTACTCGAGTACCATTCCAACATAAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014515.1-1139s1c1
Sequence:CCGGCGGGTTACTAACATTCCTCAACTCGAGTTGAGGAATGTTAGTAACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-161s1c1
Sequence:CCGGCAGGTGACAAACAGCATGTTTCTCGAGAAACATGCTGTTTGTCACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014515.4-2639s21c1
Sequence:CCGGGTGAAGATCCTTCTCGTATTTCTCGAGAAATACGAGAAGGATCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014515.4-1426s21c1
Sequence:CCGGTTACCAGGCTCCAGCTATAAACTCGAGTTTATAGCTGGAGCCTGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014515.4-1826s21c1
Sequence:CCGGATGTTCCATCTGAGTACTTAACTCGAGTTAAGTACTCAGATGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014515.4-1927s21c1
Sequence:CCGGATGAATGGAGGAGACGTATTACTCGAGTAATACGTCTCCTCCATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014515
VALIDATED
CNOT2 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-395s1c1
Sequence:CCGGCCTCAGTTAAATCGCAGCTTACTCGAGTAAGCTGCGATTTAACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-1513s1c1
Sequence:CCGGCCGTGATTGGAGATACCACAACTCGAGTTGTGGTATCTCCAATCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-881s1c1
Sequence:CCGGGCTCCTTATGTTGGAATGGTACTCGAGTACCATTCCAACATAAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014515.1-1139s1c1
Sequence:CCGGCGGGTTACTAACATTCCTCAACTCGAGTTGAGGAATGTTAGTAACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-161s1c1
Sequence:CCGGCAGGTGACAAACAGCATGTTTCTCGAGAAACATGCTGTTTGTCACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014515.4-2639s21c1
Sequence:CCGGGTGAAGATCCTTCTCGTATTTCTCGAGAAATACGAGAAGGATCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014515.4-1426s21c1
Sequence:CCGGTTACCAGGCTCCAGCTATAAACTCGAGTTTATAGCTGGAGCCTGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014515.4-1826s21c1
Sequence:CCGGATGTTCCATCTGAGTACTTAACTCGAGTTAAGTACTCAGATGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014515.4-1927s21c1
Sequence:CCGGATGAATGGAGGAGACGTATTACTCGAGTAATACGTCTCCTCCATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014515
VALIDATED
CNOT2 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-395s1c1
Sequence:CCGGCCTCAGTTAAATCGCAGCTTACTCGAGTAAGCTGCGATTTAACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-1513s1c1
Sequence:CCGGCCGTGATTGGAGATACCACAACTCGAGTTGTGGTATCTCCAATCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-881s1c1
Sequence:CCGGGCTCCTTATGTTGGAATGGTACTCGAGTACCATTCCAACATAAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014515.1-1139s1c1
Sequence:CCGGCGGGTTACTAACATTCCTCAACTCGAGTTGAGGAATGTTAGTAACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014515.1-161s1c1
Sequence:CCGGCAGGTGACAAACAGCATGTTTCTCGAGAAACATGCTGTTTGTCACCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014515.4-2639s21c1
Sequence:CCGGGTGAAGATCCTTCTCGTATTTCTCGAGAAATACGAGAAGGATCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014515.4-1426s21c1
Sequence:CCGGTTACCAGGCTCCAGCTATAAACTCGAGTTTATAGCTGGAGCCTGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014515.4-1826s21c1
Sequence:CCGGATGTTCCATCTGAGTACTTAACTCGAGTTAAGTACTCAGATGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014515.4-1927s21c1
Sequence:CCGGATGAATGGAGGAGACGTATTACTCGAGTAATACGTCTCCTCCATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028082
VALIDATED
CNOT2 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028082.1-1941s1c1
Sequence:CCGGGCATTGTTCATTGTAGCACTACTCGAGTAGTGCTACAATGAACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028082.1-680s1c1
Sequence:CCGGCGGCAACCCAACTCCATTAATCTCGAGATTAATGGAGTTGGGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-1251s1c1
Sequence:CCGGGCAATCAAACTTGGCCGATATCTCGAGATATCGGCCAAGTTTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-978s1c1
Sequence:CCGGCGAGTTACTAACATTCCTCAACTCGAGTTGAGGAATGTTAGTAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-632s1c1
Sequence:CCGGCCTTTCAGATTTCCCAGCGTTCTCGAGAACGCTGGGAAATCTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-916s21c1
Sequence:CCGGTGACGACAGCAAATCTAATTTCTCGAGAAATTAGATTTGCTGTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-773s21c1
Sequence:CCGGCTCAATACACAACGAAGATTTCTCGAGAAATCTTCGTTGTGTATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-647s21c1
Sequence:CCGGAGCGTTAGCTGACCGGAATAGCTCGAGCTATTCCGGTCAGCTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-571s21c1
Sequence:CCGGACTCCTTATCAAGTAACATTTCTCGAGAAATGTTACTTGATAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-1998s21c1
Sequence:CCGGGTGAAGATCCTTCTCGTATTTCTCGAGAAATACGAGAAGGATCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-1796s21c1
Sequence:CCGGGGTCCTGCCTTACCAATTATGCTCGAGCATAATTGGTAAGGCAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-801s21c1
Sequence:CCGGTTACCTGGTTCCAGCTATAAACTCGAGTTTATAGCTGGAACCAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-1276s21c1
Sequence:CCGGCCATGTTCCATCAGAATATTTCTCGAGAAATATTCTGATGGAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028082
VALIDATED
CNOT2 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028082.1-1941s1c1
Sequence:CCGGGCATTGTTCATTGTAGCACTACTCGAGTAGTGCTACAATGAACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028082.1-680s1c1
Sequence:CCGGCGGCAACCCAACTCCATTAATCTCGAGATTAATGGAGTTGGGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-1251s1c1
Sequence:CCGGGCAATCAAACTTGGCCGATATCTCGAGATATCGGCCAAGTTTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-978s1c1
Sequence:CCGGCGAGTTACTAACATTCCTCAACTCGAGTTGAGGAATGTTAGTAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-632s1c1
Sequence:CCGGCCTTTCAGATTTCCCAGCGTTCTCGAGAACGCTGGGAAATCTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-916s21c1
Sequence:CCGGTGACGACAGCAAATCTAATTTCTCGAGAAATTAGATTTGCTGTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-773s21c1
Sequence:CCGGCTCAATACACAACGAAGATTTCTCGAGAAATCTTCGTTGTGTATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-647s21c1
Sequence:CCGGAGCGTTAGCTGACCGGAATAGCTCGAGCTATTCCGGTCAGCTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-571s21c1
Sequence:CCGGACTCCTTATCAAGTAACATTTCTCGAGAAATGTTACTTGATAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-1998s21c1
Sequence:CCGGGTGAAGATCCTTCTCGTATTTCTCGAGAAATACGAGAAGGATCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-1796s21c1
Sequence:CCGGGGTCCTGCCTTACCAATTATGCTCGAGCATAATTGGTAAGGCAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-801s21c1
Sequence:CCGGTTACCTGGTTCCAGCTATAAACTCGAGTTTATAGCTGGAACCAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-1276s21c1
Sequence:CCGGCCATGTTCCATCAGAATATTTCTCGAGAAATATTCTGATGGAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028082
VALIDATED
CNOT2 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028082.1-1941s1c1
Sequence:CCGGGCATTGTTCATTGTAGCACTACTCGAGTAGTGCTACAATGAACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028082.1-680s1c1
Sequence:CCGGCGGCAACCCAACTCCATTAATCTCGAGATTAATGGAGTTGGGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-1251s1c1
Sequence:CCGGGCAATCAAACTTGGCCGATATCTCGAGATATCGGCCAAGTTTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-978s1c1
Sequence:CCGGCGAGTTACTAACATTCCTCAACTCGAGTTGAGGAATGTTAGTAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028082.1-632s1c1
Sequence:CCGGCCTTTCAGATTTCCCAGCGTTCTCGAGAACGCTGGGAAATCTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-916s21c1
Sequence:CCGGTGACGACAGCAAATCTAATTTCTCGAGAAATTAGATTTGCTGTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-773s21c1
Sequence:CCGGCTCAATACACAACGAAGATTTCTCGAGAAATCTTCGTTGTGTATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-647s21c1
Sequence:CCGGAGCGTTAGCTGACCGGAATAGCTCGAGCTATTCCGGTCAGCTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-571s21c1
Sequence:CCGGACTCCTTATCAAGTAACATTTCTCGAGAAATGTTACTTGATAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-1998s21c1
Sequence:CCGGGTGAAGATCCTTCTCGTATTTCTCGAGAAATACGAGAAGGATCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-1796s21c1
Sequence:CCGGGGTCCTGCCTTACCAATTATGCTCGAGCATAATTGGTAAGGCAGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.1-801s21c1
Sequence:CCGGTTACCTGGTTCCAGCTATAAACTCGAGTTTATAGCTGGAACCAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028082.2-1276s21c1
Sequence:CCGGCCATGTTCCATCAGAATATTTCTCGAGAAATATTCTGATGGAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)