EMAIL THIS PAGE TO A FRIEND

CNOT3

CCR4-NOT transcription complex, subunit 3

50 Gene Product Result for
Synonyms: LENG2 NOT3 NOT3H
UniProtKB ID: O75175, Q9NZN7, Q9UF76
Gene ID:
Mouse(232791) CCR4-NOT transcription complex, subunit 3
Rat(308311) CCR4-NOT transcription complex, subunit 3
dog(484312) CCR4-NOT transcription complex, subunit 3
cow(527305) CCR4-NOT transcription complex, subunit 3
domestic cat(101080754) CCR4-NOT transcription complex, subunit 3
sheep(101107815) CCR4-NOT transcription complex, subunit 3
Domestic Rabbit(100328776) CCR4-NOT transcription complex, subunit 3
naked mole-rat(101726127) CCR4-NOT transcription complex, subunit 3
domestic guinea pig(100733669) CCR4-NOT transcription complex, subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014516 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014516 Rosetta Predictions human pricing
NM_001107471 Rosetta Predictions rat pricing
NM_146176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242790 predicted 315
2 SASI_Hs01_00242791 predicted 807
3 SASI_Hs01_00242792 predicted 2444
4 SASI_Hs01_00242793 predicted 320
5 SASI_Hs01_00242794 predicted 709
6 SASI_Hs01_00242795 predicted 442
7 SASI_Hs01_00242796 predicted 2391
8 SASI_Hs01_00242797 predicted 759
9 SASI_Hs01_00242798 predicted 562
10 SASI_Hs01_00242799 predicted 2472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229155 predicted 2088
2 SASI_Rn02_00229156 predicted 1866
3 SASI_Rn02_00229157 predicted 1692
4 SASI_Rn02_00229158 predicted 1722
5 SASI_Rn02_00229159 predicted 2018
6 SASI_Rn02_00229160 predicted 1984
7 SASI_Rn02_00229161 predicted 2212
8 SASI_Rn02_00229162 predicted 1772
9 SASI_Rn02_00229163 predicted 2088
10 SASI_Rn02_00229164 predicted 2311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073506 predicted 2413
2 SASI_Mm01_00073508 predicted 676
3 SASI_Mm01_00073509 predicted 362
4 SASI_Mm01_00073510 predicted 428
5 SASI_Mm01_00073511 predicted 2262
6 SASI_Mm01_00073512 predicted 2384
7 SASI_Mm01_00073513 predicted 543
8 SASI_Mm01_00073514 predicted 1727
9 SASI_Mm02_00341876 predicted 2369
10 SASI_Mm01_00073515 predicted 2274
11 SASI_Mm01_00073507 predicted 793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014516
CNOT3 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014516.2-790s21c1
Sequence:CCGGAGGATAAGCAGGACCGGATTGCTCGAGCAATCCGGTCCTGCTTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014516.2-2071s21c1
Sequence:CCGGAGCTGTCAGAGGTGAACATACCTCGAGGTATGTTCACCTCTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014516.2-2636s1c1
Sequence:CCGGGCCCTGCCCTGGAAGACTGGACTCGAGTCCAGTCTTCCAGGGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-2472s1c1
Sequence:CCGGCAGGGCACCTACATCTACTTTCTCGAGAAAGTAGATGTAGGTGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-376s1c1
Sequence:CCGGTGGAGCAGTTTGAAGATATTTCTCGAGAAATATCTTCAAACTGCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-968s1c1
Sequence:CCGGCGAGGAGAACGAGTTTCTCTACTCGAGTAGAGAAACTCGTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-536s1c1
Sequence:CCGGGCAGCTTATAGACAACCGCAACTCGAGTTGCGGTTGTCTATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014516
CNOT3 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014516.2-790s21c1
Sequence:CCGGAGGATAAGCAGGACCGGATTGCTCGAGCAATCCGGTCCTGCTTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014516.2-2071s21c1
Sequence:CCGGAGCTGTCAGAGGTGAACATACCTCGAGGTATGTTCACCTCTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014516.2-2636s1c1
Sequence:CCGGGCCCTGCCCTGGAAGACTGGACTCGAGTCCAGTCTTCCAGGGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-2472s1c1
Sequence:CCGGCAGGGCACCTACATCTACTTTCTCGAGAAAGTAGATGTAGGTGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-376s1c1
Sequence:CCGGTGGAGCAGTTTGAAGATATTTCTCGAGAAATATCTTCAAACTGCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-968s1c1
Sequence:CCGGCGAGGAGAACGAGTTTCTCTACTCGAGTAGAGAAACTCGTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-536s1c1
Sequence:CCGGGCAGCTTATAGACAACCGCAACTCGAGTTGCGGTTGTCTATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014516
CNOT3 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014516.2-790s21c1
Sequence:CCGGAGGATAAGCAGGACCGGATTGCTCGAGCAATCCGGTCCTGCTTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014516.2-2071s21c1
Sequence:CCGGAGCTGTCAGAGGTGAACATACCTCGAGGTATGTTCACCTCTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014516.2-2636s1c1
Sequence:CCGGGCCCTGCCCTGGAAGACTGGACTCGAGTCCAGTCTTCCAGGGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-2472s1c1
Sequence:CCGGCAGGGCACCTACATCTACTTTCTCGAGAAAGTAGATGTAGGTGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-376s1c1
Sequence:CCGGTGGAGCAGTTTGAAGATATTTCTCGAGAAATATCTTCAAACTGCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-968s1c1
Sequence:CCGGCGAGGAGAACGAGTTTCTCTACTCGAGTAGAGAAACTCGTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014516.2-536s1c1
Sequence:CCGGGCAGCTTATAGACAACCGCAACTCGAGTTGCGGTTGTCTATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146176
CNOT3 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-2376s21c1
Sequence:CCGGGCGATTCCACACCAAGTATATCTCGAGATATACTTGGTGTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-943s21c1
Sequence:CCGGCCCGACTTTGAAGAGAACGAACTCGAGTTCGTTCTCTTCAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-536s21c1
Sequence:CCGGGCAAGCTCATTGAGACGCAAACTCGAGTTTGCGTCTCAATGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-1969s21c1
Sequence:CCGGCCAACGTTACACCTAACTGATCTCGAGATCAGTTAGGTGTAACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146176.1-2662s1c1
Sequence:CCGGCCCAGGAAGCAGGGAAGGGATCTCGAGATCCCTTCCCTGCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-537s1c1
Sequence:CCGGGCAAGCTCATTGAGACGCAAACTCGAGTTTGCGTCTCAATGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-944s1c1
Sequence:CCGGCCCGACTTTGAAGAGAACGAACTCGAGTTCGTTCTCTTCAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-2377s1c1
Sequence:CCGGGCGATTCCACACCAAGTATATCTCGAGATATACTTGGTGTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-1970s1c1
Sequence:CCGGCCAACGTTACACCTAACTGATCTCGAGATCAGTTAGGTGTAACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146176
CNOT3 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-2376s21c1
Sequence:CCGGGCGATTCCACACCAAGTATATCTCGAGATATACTTGGTGTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-943s21c1
Sequence:CCGGCCCGACTTTGAAGAGAACGAACTCGAGTTCGTTCTCTTCAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-536s21c1
Sequence:CCGGGCAAGCTCATTGAGACGCAAACTCGAGTTTGCGTCTCAATGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-1969s21c1
Sequence:CCGGCCAACGTTACACCTAACTGATCTCGAGATCAGTTAGGTGTAACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146176.1-2662s1c1
Sequence:CCGGCCCAGGAAGCAGGGAAGGGATCTCGAGATCCCTTCCCTGCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-537s1c1
Sequence:CCGGGCAAGCTCATTGAGACGCAAACTCGAGTTTGCGTCTCAATGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-944s1c1
Sequence:CCGGCCCGACTTTGAAGAGAACGAACTCGAGTTCGTTCTCTTCAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-2377s1c1
Sequence:CCGGGCGATTCCACACCAAGTATATCTCGAGATATACTTGGTGTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-1970s1c1
Sequence:CCGGCCAACGTTACACCTAACTGATCTCGAGATCAGTTAGGTGTAACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146176
CNOT3 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-2376s21c1
Sequence:CCGGGCGATTCCACACCAAGTATATCTCGAGATATACTTGGTGTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-943s21c1
Sequence:CCGGCCCGACTTTGAAGAGAACGAACTCGAGTTCGTTCTCTTCAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-536s21c1
Sequence:CCGGGCAAGCTCATTGAGACGCAAACTCGAGTTTGCGTCTCAATGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146176.2-1969s21c1
Sequence:CCGGCCAACGTTACACCTAACTGATCTCGAGATCAGTTAGGTGTAACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146176.1-2662s1c1
Sequence:CCGGCCCAGGAAGCAGGGAAGGGATCTCGAGATCCCTTCCCTGCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-537s1c1
Sequence:CCGGGCAAGCTCATTGAGACGCAAACTCGAGTTTGCGTCTCAATGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-944s1c1
Sequence:CCGGCCCGACTTTGAAGAGAACGAACTCGAGTTCGTTCTCTTCAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-2377s1c1
Sequence:CCGGGCGATTCCACACCAAGTATATCTCGAGATATACTTGGTGTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146176.1-1970s1c1
Sequence:CCGGCCAACGTTACACCTAACTGATCTCGAGATCAGTTAGGTGTAACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks