EMAIL THIS PAGE TO A FRIEND

CNOT4

CCR4-NOT transcription complex, subunit 4

224 Gene Product Result for
Synonyms: CLONE243 NOT4 NOT4H
Gene ID:
Human(4850) Summary: The protein encoded by this gene is a subunit of the CCR4-NOT complex, a global transcriptional regulator. The encoded protein interacts with CNOT1 and has E3 ubiquitin ligase activity. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
Mouse(53621) CCR4-NOT transcription complex, subunit 4
Rat(312227) CCR4-NOT transcription complex, subunit 4
fruit fly(34416) Cnot 4 homologue
dog(482708) CCR4-NOT transcription complex, subunit 4
cow(540891) CCR4-NOT transcription complex, subunit 4
Horse(100065026) CCR4-NOT transcription complex, subunit 4
domestic cat(101096800) CCR4-NOT transcription complex, subunit 4
chicken(417936) CCR4-NOT transcription complex, subunit 4
domestic guinea pig(100721176) CCR4-NOT transcription complex, subunit 4
naked mole-rat(101711678) CCR4-NOT transcription complex, subunit 4
sheep(101123114) CCR4-NOT transcription complex, subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008225 Rosetta Predictions human pricing
NM_013316 Rosetta Predictions human pricing
NM_001037782 Rosetta Predictions rat pricing
NM_016877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305386 predicted 1150
2 SASI_Hs01_00218339 predicted 1283
3 SASI_Hs01_00218340 predicted 983
4 SASI_Hs01_00218341 predicted 1018
5 SASI_Hs01_00218342 predicted 930
6 SASI_Hs01_00218343 predicted 1297
7 SASI_Hs01_00218344 predicted 819
8 SASI_Hs02_00305387 predicted 1598
9 SASI_Hs01_00218345 predicted 1667
10 SASI_Hs01_00218346 predicted 1166
11 SASI_Hs01_00218347 predicted 1061
12 SASI_Hs01_00218348 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344608 predicted 1153
2 SASI_Hs01_00014934 predicted 1282
3 SASI_Hs01_00014935 predicted 978
4 SASI_Hs01_00014936 predicted 1016
5 SASI_Hs01_00014937 predicted 929
6 SASI_Hs01_00014938 predicted 1292
7 SASI_Hs01_00014939 predicted 813
8 SASI_Hs02_00344609 predicted 1606
9 SASI_Hs01_00014940 predicted 1673
10 SASI_Hs01_00014941 predicted 1164
11 SASI_Hs01_00014942 predicted 1063
12 SASI_Hs01_00014943 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068376 predicted 1722
2 SASI_Rn02_00204584 predicted 823
3 SASI_Rn01_00068377 predicted 2136
4 SASI_Rn01_00068378 predicted 1820
5 SASI_Rn02_00204585 predicted 1130
6 SASI_Rn01_00068379 predicted 1114
7 SASI_Rn01_00068380 predicted 1401
8 SASI_Rn01_00068381 predicted 1579
9 SASI_Rn01_00068382 predicted 1349
10 SASI_Rn01_00068383 predicted 827
11 SASI_Rn01_00068384 predicted 1225
12 SASI_Rn01_00068385 predicted 1793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163506 predicted 1103
2 SASI_Mm01_00163507 predicted 1858
3 SASI_Mm01_00163508 predicted 2111
4 SASI_Mm01_00163509 predicted 857
5 SASI_Mm01_00163510 predicted 1158
6 SASI_Mm01_00163511 predicted 1141
7 SASI_Mm01_00163512 predicted 822
8 SASI_Mm01_00163513 predicted 2002
9 SASI_Mm01_00163514 predicted 1429
10 SASI_Mm02_00323686 predicted 2116
11 SASI_Mm01_00163505 predicted 1765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013316
VALIDATED
CNOT4 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-3140s1c1
Sequence:CCGGCCCTGTAGTTTCTGGACGTTTCTCGAGAAACGTCCAGAAACTACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013316.1-751s1c1
Sequence:CCGGCCAGTGCTTATGTAACCTATACTCGAGTATAGGTTACATAAGCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013316.1-1142s1c1
Sequence:CCGGCGGTGATAATTCCCAGCAGATCTCGAGATCTGCTGGGAATTATCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-338s1c1
Sequence:CCGGGCCCTTGGAGATAGATGATATCTCGAGATATCATCTATCTCCAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-1395s1c1
Sequence:CCGGGCCTCTTCACATCAGAAACAACTCGAGTTGTTTCTGATGTGAAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013316.2-2584s21c1
Sequence:CCGGCTATAGGAAAGCTCAAGTAAACTCGAGTTTACTTGAGCTTTCCTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-1289s21c1
Sequence:CCGGACAGAGTCACAGTCGTTATTCCTCGAGGAATAACGACTGTGACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-1147s21c1
Sequence:CCGGCAGTATAGGGAACGGTGATAACTCGAGTTATCACCGTTCCCTATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-636s21c1
Sequence:CCGGTCGTCTTTGTTGTAGGTTTATCTCGAGATAAACCTACAACAAAGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-407s21c1
Sequence:CCGGGGCTACCAGATTTGCCGATTTCTCGAGAAATCGGCAAATCTGGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013316
VALIDATED
CNOT4 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-3140s1c1
Sequence:CCGGCCCTGTAGTTTCTGGACGTTTCTCGAGAAACGTCCAGAAACTACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013316.1-751s1c1
Sequence:CCGGCCAGTGCTTATGTAACCTATACTCGAGTATAGGTTACATAAGCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013316.1-1142s1c1
Sequence:CCGGCGGTGATAATTCCCAGCAGATCTCGAGATCTGCTGGGAATTATCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-338s1c1
Sequence:CCGGGCCCTTGGAGATAGATGATATCTCGAGATATCATCTATCTCCAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-1395s1c1
Sequence:CCGGGCCTCTTCACATCAGAAACAACTCGAGTTGTTTCTGATGTGAAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013316.2-2584s21c1
Sequence:CCGGCTATAGGAAAGCTCAAGTAAACTCGAGTTTACTTGAGCTTTCCTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-1289s21c1
Sequence:CCGGACAGAGTCACAGTCGTTATTCCTCGAGGAATAACGACTGTGACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-1147s21c1
Sequence:CCGGCAGTATAGGGAACGGTGATAACTCGAGTTATCACCGTTCCCTATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-636s21c1
Sequence:CCGGTCGTCTTTGTTGTAGGTTTATCTCGAGATAAACCTACAACAAAGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-407s21c1
Sequence:CCGGGGCTACCAGATTTGCCGATTTCTCGAGAAATCGGCAAATCTGGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013316
VALIDATED
CNOT4 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-3140s1c1
Sequence:CCGGCCCTGTAGTTTCTGGACGTTTCTCGAGAAACGTCCAGAAACTACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013316.1-751s1c1
Sequence:CCGGCCAGTGCTTATGTAACCTATACTCGAGTATAGGTTACATAAGCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013316.1-1142s1c1
Sequence:CCGGCGGTGATAATTCCCAGCAGATCTCGAGATCTGCTGGGAATTATCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-338s1c1
Sequence:CCGGGCCCTTGGAGATAGATGATATCTCGAGATATCATCTATCTCCAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_013316.1-1395s1c1
Sequence:CCGGGCCTCTTCACATCAGAAACAACTCGAGTTGTTTCTGATGTGAAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013316.2-2584s21c1
Sequence:CCGGCTATAGGAAAGCTCAAGTAAACTCGAGTTTACTTGAGCTTTCCTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-1289s21c1
Sequence:CCGGACAGAGTCACAGTCGTTATTCCTCGAGGAATAACGACTGTGACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-1147s21c1
Sequence:CCGGCAGTATAGGGAACGGTGATAACTCGAGTTATCACCGTTCCCTATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-636s21c1
Sequence:CCGGTCGTCTTTGTTGTAGGTTTATCTCGAGATAAACCTACAACAAAGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_013316.2-407s21c1
Sequence:CCGGGGCTACCAGATTTGCCGATTTCTCGAGAAATCGGCAAATCTGGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016877
VALIDATED
CNOT4 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016877.2-2812s1c1
Sequence:CCGGCGTATGTAAGTAGTAGCCATACTCGAGTATGGCTACTACTTACATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016877.2-1131s1c1
Sequence:CCGGCCCATTGACAAACCTTCAGATCTCGAGATCTGAAGGTTTGTCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-1075s1c1
Sequence:CCGGCGGGTTCAGTTGATAAGAATACTCGAGTATTCTTATCAACTGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-366s1c1
Sequence:CCGGCCCTTGGAAATAGATGATATTCTCGAGAATATCATCTATTTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-777s1c1
Sequence:CCGGGCCAGTGCTTATGTAACGTATCTCGAGATACGTTACATAAGCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016877.3-1157s21c1
Sequence:CCGGGTATAGGGAATGGTGATAATTCTCGAGAATTATCACCATTCCCTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016877.3-398s21c1
Sequence:CCGGGCACCTGTGGCTACCAGATATCTCGAGATATCTGGTAGCCACAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016877.3-1107s21c1
Sequence:CCGGACCATTACAAAGGTATGATACCTCGAGGTATCATACCTTTGTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016877.3-1669s21c1
Sequence:CCGGCACTCTGCTGCACCTACAAATCTCGAGATTTGTAGGTGCAGCAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016877.3-2179s21c1
Sequence:CCGGGTGGACCTCGTAGTTGCTAAACTCGAGTTTAGCAACTACGAGGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016877
VALIDATED
CNOT4 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016877.2-2812s1c1
Sequence:CCGGCGTATGTAAGTAGTAGCCATACTCGAGTATGGCTACTACTTACATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016877.2-1131s1c1
Sequence:CCGGCCCATTGACAAACCTTCAGATCTCGAGATCTGAAGGTTTGTCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-1075s1c1
Sequence:CCGGCGGGTTCAGTTGATAAGAATACTCGAGTATTCTTATCAACTGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-366s1c1
Sequence:CCGGCCCTTGGAAATAGATGATATTCTCGAGAATATCATCTATTTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-777s1c1
Sequence:CCGGGCCAGTGCTTATGTAACGTATCTCGAGATACGTTACATAAGCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016877.3-1157s21c1
Sequence:CCGGGTATAGGGAATGGTGATAATTCTCGAGAATTATCACCATTCCCTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016877.3-398s21c1
Sequence:CCGGGCACCTGTGGCTACCAGATATCTCGAGATATCTGGTAGCCACAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016877.3-1107s21c1
Sequence:CCGGACCATTACAAAGGTATGATACCTCGAGGTATCATACCTTTGTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016877.3-1669s21c1
Sequence:CCGGCACTCTGCTGCACCTACAAATCTCGAGATTTGTAGGTGCAGCAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016877.3-2179s21c1
Sequence:CCGGGTGGACCTCGTAGTTGCTAAACTCGAGTTTAGCAACTACGAGGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016877
VALIDATED
CNOT4 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016877.2-2812s1c1
Sequence:CCGGCGTATGTAAGTAGTAGCCATACTCGAGTATGGCTACTACTTACATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016877.2-1131s1c1
Sequence:CCGGCCCATTGACAAACCTTCAGATCTCGAGATCTGAAGGTTTGTCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-1075s1c1
Sequence:CCGGCGGGTTCAGTTGATAAGAATACTCGAGTATTCTTATCAACTGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-366s1c1
Sequence:CCGGCCCTTGGAAATAGATGATATTCTCGAGAATATCATCTATTTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016877.2-777s1c1
Sequence:CCGGGCCAGTGCTTATGTAACGTATCTCGAGATACGTTACATAAGCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016877.3-1157s21c1
Sequence:CCGGGTATAGGGAATGGTGATAATTCTCGAGAATTATCACCATTCCCTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016877.3-398s21c1
Sequence:CCGGGCACCTGTGGCTACCAGATATCTCGAGATATCTGGTAGCCACAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016877.3-1107s21c1
Sequence:CCGGACCATTACAAAGGTATGATACCTCGAGGTATCATACCTTTGTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016877.3-1669s21c1
Sequence:CCGGCACTCTGCTGCACCTACAAATCTCGAGATTTGTAGGTGCAGCAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016877.3-2179s21c1
Sequence:CCGGGTGGACCTCGTAGTTGCTAAACTCGAGTTTAGCAACTACGAGGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)