EMAIL THIS PAGE TO A FRIEND

CNOT6

CCR4-NOT transcription complex, subunit 6

292 Gene Product Result for
Synonyms: CCR4
UniProtKB ID: Q9ULM6, A7MD46, D3DWR0
Gene ID:
Human(57472) Summary: The protein encoded by this gene is a subunit of the CCR4-NOT core transcriptional regulation complex. The encoded protein has a 3'-5' RNase activity and prefers polyadenylated substates. [provided by RefSeq, Jul 2008]
Mouse(104625) CCR4-NOT transcription complex, subunit 6
Rat(287249) CCR4-NOT transcription complex, subunit 6
Zebrafish(324048) CCR4-NOT transcription complex, subunit 6
cow(534707) CCR4-NOT transcription complex, subunit 6
Horse(100057912) CCR4-NOT transcription complex, subunit 6
domestic cat(101084253) CCR4-NOT transcription complex, subunit 6
dog(481463) CCR4-NOT transcription complex, subunit 6
chicken(416293) CCR4-NOT transcription complex, subunit 6
sheep(101120323) CCR4-NOT transcription complex, subunit 6
naked mole-rat(101700106) CCR4-NOT transcription complex, subunit 6
domestic guinea pig(100715268) CCR4-NOT transcription complex, subunit 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_203423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_203423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_203423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015455 Rosetta Predictions human pricing
NM_001013856 Rosetta Predictions rat pricing
NM_212484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243572 predicted 792
2 SASI_Hs02_00347864 predicted 666
3 SASI_Hs01_00243573 predicted 1098
4 SASI_Hs01_00243574 predicted 1467
5 SASI_Hs02_00347865 predicted 550
6 SASI_Hs01_00243576 predicted 2085
7 SASI_Hs01_00243577 predicted 1398
8 SASI_Hs01_00243578 predicted 466
9 SASI_Hs01_00243579 predicted 520
10 SASI_Hs01_00243581 predicted 1648
11 SASI_Hs01_00243575 predicted 583
12 SASI_Hs01_00243580 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059029 predicted 784
2 SASI_Rn01_00059030 predicted 1348
3 SASI_Rn01_00059031 predicted 1853
4 SASI_Rn01_00059033 predicted 1711
5 SASI_Rn01_00059034 predicted 455
6 SASI_Rn01_00059036 predicted 725
7 SASI_Rn02_00201119 predicted 394
8 SASI_Rn01_00059038 predicted 418
9 SASI_Rn02_00201120 predicted 1496
10 SASI_Rn02_00201121 predicted 1376
11 SASI_Rn01_00059032 predicted 926
12 SASI_Rn01_00059035 predicted 601
13 SASI_Rn01_00059037 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048123 predicted 1408
2 SASI_Mm02_00352283 predicted 1467
3 SASI_Mm01_00048124 predicted 801
4 SASI_Mm01_00048125 predicted 792
5 SASI_Mm01_00048126 predicted 852
6 SASI_Mm01_00048127 predicted 474
7 SASI_Mm01_00048128 predicted 1558
8 SASI_Mm01_00048129 predicted 718
9 SASI_Mm01_00048130 predicted 1295
10 SASI_Mm01_00048131 predicted 919
11 SASI_Mm01_00048132 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015455
CNOT6 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-480s21c1
Sequence:CCGGGCGCATCTTTGTGGTCACTAACTCGAGTTAGTGACCACAAAGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-748s21c1
Sequence:CCGGCCAGGATATATTGAACCTTTACTCGAGTAAAGGTTCAATATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-512s21c1
Sequence:CCGGGCTTTGCATTTGAGTGACAATCTCGAGATTGTCACTCAAATGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-1807s21c1
Sequence:CCGGCAAGGGTATAATAGACTACATCTCGAGATGTAGTCTATTATACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-587s1c1
Sequence:CCGGGCTTTGCATTTGAGTGACAATCTCGAGATTGTCACTCAAATGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-823s1c1
Sequence:CCGGCCAGGATATATTGAACCTTTACTCGAGTAAAGGTTCAATATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-555s1c1
Sequence:CCGGGCGCATCTTTGTGGTCACTAACTCGAGTTAGTGACCACAAAGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-1882s1c1
Sequence:CCGGCAAGGGTATAATAGACTACATCTCGAGATGTAGTCTATTATACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-1599s1c1
Sequence:CCGGGCAACCTCAAATCCAGTGTTTCTCGAGAAACACTGGATTTGAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015455
CNOT6 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-480s21c1
Sequence:CCGGGCGCATCTTTGTGGTCACTAACTCGAGTTAGTGACCACAAAGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-748s21c1
Sequence:CCGGCCAGGATATATTGAACCTTTACTCGAGTAAAGGTTCAATATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-512s21c1
Sequence:CCGGGCTTTGCATTTGAGTGACAATCTCGAGATTGTCACTCAAATGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-1807s21c1
Sequence:CCGGCAAGGGTATAATAGACTACATCTCGAGATGTAGTCTATTATACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-587s1c1
Sequence:CCGGGCTTTGCATTTGAGTGACAATCTCGAGATTGTCACTCAAATGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-823s1c1
Sequence:CCGGCCAGGATATATTGAACCTTTACTCGAGTAAAGGTTCAATATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-555s1c1
Sequence:CCGGGCGCATCTTTGTGGTCACTAACTCGAGTTAGTGACCACAAAGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-1882s1c1
Sequence:CCGGCAAGGGTATAATAGACTACATCTCGAGATGTAGTCTATTATACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-1599s1c1
Sequence:CCGGGCAACCTCAAATCCAGTGTTTCTCGAGAAACACTGGATTTGAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015455
CNOT6 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-480s21c1
Sequence:CCGGGCGCATCTTTGTGGTCACTAACTCGAGTTAGTGACCACAAAGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-748s21c1
Sequence:CCGGCCAGGATATATTGAACCTTTACTCGAGTAAAGGTTCAATATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-512s21c1
Sequence:CCGGGCTTTGCATTTGAGTGACAATCTCGAGATTGTCACTCAAATGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015455.3-1807s21c1
Sequence:CCGGCAAGGGTATAATAGACTACATCTCGAGATGTAGTCTATTATACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-587s1c1
Sequence:CCGGGCTTTGCATTTGAGTGACAATCTCGAGATTGTCACTCAAATGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-823s1c1
Sequence:CCGGCCAGGATATATTGAACCTTTACTCGAGTAAAGGTTCAATATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-555s1c1
Sequence:CCGGGCGCATCTTTGTGGTCACTAACTCGAGTTAGTGACCACAAAGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-1882s1c1
Sequence:CCGGCAAGGGTATAATAGACTACATCTCGAGATGTAGTCTATTATACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015455.2-1599s1c1
Sequence:CCGGGCAACCTCAAATCCAGTGTTTCTCGAGAAACACTGGATTTGAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_203423
VALIDATED
CNOT6 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203423.3-1151s1c1
Sequence:CCGGCGGACTATGTCTGAACAAGAACTCGAGTTCTTGTTCAGACATAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-1597s1c1
Sequence:CCGGCTCTGGTGTTGTAGAGTATTTCTCGAGAAATACTCTACAACACCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-1148s1c1
Sequence:CCGGGCTCGGACTATGTCTGAACAACTCGAGTTGTTCAGACATAGTCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-788s1c1
Sequence:CCGGCTACTGAACTACTTGCTCGATCTCGAGATCGAGCAAGTAGTTCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-588s1c1
Sequence:CCGGCCCATAATCAAATCCAGAGTTCTCGAGAACTCTGGATTTGATTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_203423
VALIDATED
CNOT6 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203423.3-1151s1c1
Sequence:CCGGCGGACTATGTCTGAACAAGAACTCGAGTTCTTGTTCAGACATAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-1597s1c1
Sequence:CCGGCTCTGGTGTTGTAGAGTATTTCTCGAGAAATACTCTACAACACCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-1148s1c1
Sequence:CCGGGCTCGGACTATGTCTGAACAACTCGAGTTGTTCAGACATAGTCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-788s1c1
Sequence:CCGGCTACTGAACTACTTGCTCGATCTCGAGATCGAGCAAGTAGTTCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-588s1c1
Sequence:CCGGCCCATAATCAAATCCAGAGTTCTCGAGAACTCTGGATTTGATTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_203423
VALIDATED
CNOT6 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203423.3-1151s1c1
Sequence:CCGGCGGACTATGTCTGAACAAGAACTCGAGTTCTTGTTCAGACATAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-1597s1c1
Sequence:CCGGCTCTGGTGTTGTAGAGTATTTCTCGAGAAATACTCTACAACACCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-1148s1c1
Sequence:CCGGGCTCGGACTATGTCTGAACAACTCGAGTTGTTCAGACATAGTCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-788s1c1
Sequence:CCGGCTACTGAACTACTTGCTCGATCTCGAGATCGAGCAAGTAGTTCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_203423.3-588s1c1
Sequence:CCGGCCCATAATCAAATCCAGAGTTCTCGAGAACTCTGGATTTGATTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)