EMAIL THIS PAGE TO A FRIEND

CNOT6L

CCR4-NOT transcription complex, subunit 6-like

331 Gene Product Result for
Synonyms: CCR4b
UniProtKB ID: Q96LI5, Q9UF92
Gene ID:
Mouse(231464) CCR4-NOT transcription complex, subunit 6-like
Rat(360917) CCR4-NOT transcription complex, subunit 6-like
domestic guinea pig(100719915) CCR4-NOT transcription complex, subunit 6-like
naked mole-rat(101708643) CCR4-NOT transcription complex, subunit 6-like
sheep(101111369) CCR4-NOT transcription complex, subunit 6-like
Domestic Rabbit(100350183) CCR4-NOT transcription complex, subunit 6-like
Zebrafish(553665) CCR4-NOT transcription complex, subunit 6-like
cow(518225) CCR4-NOT transcription complex, subunit 6-like
Horse(100059049) CCR4-NOT transcription complex, subunit 6-like
domestic cat(101096648) CCR4-NOT transcription complex, subunit 6-like
dog(487817) CCR4-NOT transcription complex, subunit 6-like
chicken(422508) CCR4-NOT transcription complex, subunit 6-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144571 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144571 Rosetta Predictions human pricing
NM_001108355 Rosetta Predictions rat pricing
NM_144910 Rosetta Predictions mouse pricing
NM_178854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196408 predicted 1123
2 SASI_Hs01_00196409 predicted 694
3 SASI_Hs02_00364342 predicted 542
4 SASI_Hs01_00196410 predicted 1067
5 SASI_Hs02_00364343 predicted 1822
6 SASI_Hs01_00196414 predicted 831
7 SASI_Hs02_00364344 predicted 1374
8 SASI_Hs01_00196415 predicted 1172
9 SASI_Hs02_00364345 predicted 1383
10 SASI_Hs01_00196417 predicted 301
11 SASI_Hs01_00196411 predicted 649
12 SASI_Hs01_00196412 predicted 1354
13 SASI_Hs01_00196413 predicted 1098
14 SASI_Hs01_00196416 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237849 predicted 1343
2 SASI_Rn02_00237850 predicted 1463
3 SASI_Rn02_00237851 predicted 1366
4 SASI_Rn02_00237852 predicted 1026
5 SASI_Rn02_00237853 predicted 1510
6 SASI_Rn02_00237854 predicted 1239
7 SASI_Rn02_00237855 predicted 1233
8 SASI_Rn02_00237856 predicted 1870
9 SASI_Rn02_00237857 predicted 1858
10 SASI_Rn02_00237858 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340381 predicted 305
2 SASI_Mm01_00041954 predicted 615
3 SASI_Mm01_00041956 predicted 1261
4 SASI_Mm01_00041957 predicted 1135
5 SASI_Mm01_00041959 predicted 1371
6 SASI_Mm01_00041960 predicted 1279
7 SASI_Mm02_00340382 predicted 444
8 SASI_Mm01_00041961 predicted 943
9 SASI_Mm02_00340383 predicted 986
10 SASI_Mm02_00340384 predicted 1769
11 SASI_Mm01_00041953 predicted 1007
12 SASI_Mm01_00041955 predicted 1098
13 SASI_Mm01_00041958 predicted 512
14 SASI_Mm01_00041962 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349429 predicted 317
2 SASI_Mm01_00160399 predicted 630
3 SASI_Mm01_00160401 predicted 1266
4 SASI_Mm01_00160402 predicted 1153
5 SASI_Mm01_00160404 predicted 1382
6 SASI_Mm01_00160405 predicted 1295
7 SASI_Mm02_00349430 predicted 453
8 SASI_Mm01_00160406 predicted 951
9 SASI_Mm02_00349431 predicted 999
10 SASI_Mm02_00349432 predicted 1778
11 SASI_Mm01_00160398 predicted 1010
12 SASI_Mm01_00160400 predicted 1098
13 SASI_Mm01_00160403 predicted 523
14 SASI_Mm01_00160407 predicted 1434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144571
VALIDATED
CNOT6L MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 6-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_144571.1-1071s1c1
Sequence:CCGGCCCAGAGTATTCTGATGTGAACTCGAGTTCACATCAGAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144571.1-533s1c1
Sequence:CCGGCGTCAGCATCATTCACGGTTACTCGAGTAACCGTGAATGATGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144571.1-736s1c1
Sequence:CCGGGCATTGAAGGAGCGTGGATATCTCGAGATATCCACGCTCCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_144571.1-864s1c1
Sequence:CCGGGCAGAAGCATACAGTGGAATTCTCGAGAATTCCACTGTATGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-276s21c1
Sequence:GTACCGGACAATTACCTTAGTCGCATTCCTCGAGGAATGCGACTAAGGTAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-227s21c1
Sequence:GTACCGGAGTACATCACTTTGGTCATTGCTCGAGCAATGACCAAAGTGATGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144571.2-7978s21c1
Sequence:CCGGAGTCATTCTGTGACCTATAAACTCGAGTTTATAGGTCACAGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-301s21c1
Sequence:CCGGTGATATTGCCAAGCTTCATAACTCGAGTTATGAAGCTTGGCAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-254s21c1
Sequence:CCGGTTGACAGCGCTGCACCTAAATCTCGAGATTTAGGTGCAGCGCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144571
VALIDATED
CNOT6L MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 6-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_144571.1-1071s1c1
Sequence:CCGGCCCAGAGTATTCTGATGTGAACTCGAGTTCACATCAGAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144571.1-533s1c1
Sequence:CCGGCGTCAGCATCATTCACGGTTACTCGAGTAACCGTGAATGATGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144571.1-736s1c1
Sequence:CCGGGCATTGAAGGAGCGTGGATATCTCGAGATATCCACGCTCCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_144571.1-864s1c1
Sequence:CCGGGCAGAAGCATACAGTGGAATTCTCGAGAATTCCACTGTATGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-276s21c1
Sequence:GTACCGGACAATTACCTTAGTCGCATTCCTCGAGGAATGCGACTAAGGTAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-227s21c1
Sequence:GTACCGGAGTACATCACTTTGGTCATTGCTCGAGCAATGACCAAAGTGATGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144571.2-7978s21c1
Sequence:CCGGAGTCATTCTGTGACCTATAAACTCGAGTTTATAGGTCACAGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-301s21c1
Sequence:CCGGTGATATTGCCAAGCTTCATAACTCGAGTTATGAAGCTTGGCAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-254s21c1
Sequence:CCGGTTGACAGCGCTGCACCTAAATCTCGAGATTTAGGTGCAGCGCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144571
VALIDATED
CNOT6L MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 6-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_144571.1-1071s1c1
Sequence:CCGGCCCAGAGTATTCTGATGTGAACTCGAGTTCACATCAGAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144571.1-533s1c1
Sequence:CCGGCGTCAGCATCATTCACGGTTACTCGAGTAACCGTGAATGATGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144571.1-736s1c1
Sequence:CCGGGCATTGAAGGAGCGTGGATATCTCGAGATATCCACGCTCCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_144571.1-864s1c1
Sequence:CCGGGCAGAAGCATACAGTGGAATTCTCGAGAATTCCACTGTATGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-276s21c1
Sequence:GTACCGGACAATTACCTTAGTCGCATTCCTCGAGGAATGCGACTAAGGTAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-227s21c1
Sequence:GTACCGGAGTACATCACTTTGGTCATTGCTCGAGCAATGACCAAAGTGATGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144571.2-7978s21c1
Sequence:CCGGAGTCATTCTGTGACCTATAAACTCGAGTTTATAGGTCACAGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-301s21c1
Sequence:CCGGTGATATTGCCAAGCTTCATAACTCGAGTTATGAAGCTTGGCAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144571.2-254s21c1
Sequence:CCGGTTGACAGCGCTGCACCTAAATCTCGAGATTTAGGTGCAGCGCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144910
VALIDATED
CNOT6L MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 6-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144910.1-1475s1c1
Sequence:CCGGCCTTATACCAATTACACCTTTCTCGAGAAAGGTGTAATTGGTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144910.1-1094s1c1
Sequence:CCGGGCAGACAAACAGCTGCTTATACTCGAGTATAAGCAGCTGTTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144910.1-684s1c1
Sequence:CCGGCCTGGGCATTAAACTGGGAATCTCGAGATTCCCAGTTTAATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144910.1-770s1c1
Sequence:CCGGGTGGAAACAGAGCAATACTTTCTCGAGAAAGTATTGCTCTGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144910.1-1828s1c1
Sequence:CCGGCCTTTCACTATGTGTTTGCTACTCGAGTAGCAAACACATAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-770s21c1
Sequence:CCGGGTGGAAACAGAGCAATACTTTCTCGAGAAAGTATTGCTCTGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-255s21c1
Sequence:CCGGCTCGCATTCCACCTGATATTGCTCGAGCAATATCAGGTGGAATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-651s21c1
Sequence:CCGGATGCTACCAGGCAGCTATATGCTCGAGCATATAGCTGCCTGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144910.1-1329s21c1
Sequence:CCGGGAGTAGCTGACAACCATAAAGCTCGAGCTTTATGGTTGTCAGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-1864s21c1
Sequence:CCGGTTGTGCATACTGATATCATTTCTCGAGAAATGATATCAGTATGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144910
VALIDATED
CNOT6L MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 6-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144910.1-1475s1c1
Sequence:CCGGCCTTATACCAATTACACCTTTCTCGAGAAAGGTGTAATTGGTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144910.1-1094s1c1
Sequence:CCGGGCAGACAAACAGCTGCTTATACTCGAGTATAAGCAGCTGTTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144910.1-684s1c1
Sequence:CCGGCCTGGGCATTAAACTGGGAATCTCGAGATTCCCAGTTTAATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144910.1-770s1c1
Sequence:CCGGGTGGAAACAGAGCAATACTTTCTCGAGAAAGTATTGCTCTGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144910.1-1828s1c1
Sequence:CCGGCCTTTCACTATGTGTTTGCTACTCGAGTAGCAAACACATAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-770s21c1
Sequence:CCGGGTGGAAACAGAGCAATACTTTCTCGAGAAAGTATTGCTCTGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-255s21c1
Sequence:CCGGCTCGCATTCCACCTGATATTGCTCGAGCAATATCAGGTGGAATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-651s21c1
Sequence:CCGGATGCTACCAGGCAGCTATATGCTCGAGCATATAGCTGCCTGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144910.1-1329s21c1
Sequence:CCGGGAGTAGCTGACAACCATAAAGCTCGAGCTTTATGGTTGTCAGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-1864s21c1
Sequence:CCGGTTGTGCATACTGATATCATTTCTCGAGAAATGATATCAGTATGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144910
VALIDATED
CNOT6L MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 6-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144910.1-1475s1c1
Sequence:CCGGCCTTATACCAATTACACCTTTCTCGAGAAAGGTGTAATTGGTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144910.1-1094s1c1
Sequence:CCGGGCAGACAAACAGCTGCTTATACTCGAGTATAAGCAGCTGTTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144910.1-684s1c1
Sequence:CCGGCCTGGGCATTAAACTGGGAATCTCGAGATTCCCAGTTTAATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144910.1-770s1c1
Sequence:CCGGGTGGAAACAGAGCAATACTTTCTCGAGAAAGTATTGCTCTGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144910.1-1828s1c1
Sequence:CCGGCCTTTCACTATGTGTTTGCTACTCGAGTAGCAAACACATAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-770s21c1
Sequence:CCGGGTGGAAACAGAGCAATACTTTCTCGAGAAAGTATTGCTCTGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-255s21c1
Sequence:CCGGCTCGCATTCCACCTGATATTGCTCGAGCAATATCAGGTGGAATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-651s21c1
Sequence:CCGGATGCTACCAGGCAGCTATATGCTCGAGCATATAGCTGCCTGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144910.1-1329s21c1
Sequence:CCGGGAGTAGCTGACAACCATAAAGCTCGAGCTTTATGGTTGTCAGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144910.1-1864s21c1
Sequence:CCGGTTGTGCATACTGATATCATTTCTCGAGAAATGATATCAGTATGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks