EMAIL THIS PAGE TO A FRIEND

CNOT7

CCR4-NOT transcription complex, subunit 7

193 Gene Product Result for
Synonyms: CAF1 Caf1a hCAF-1
Gene ID:
Human(29883) Summary: The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The protein has both mouse and yeast orthologs. Alternate splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(18983) CCR4-NOT transcription complex, subunit 7
Rat(306492) CCR4-NOT transcription complex, subunit 7
Zebrafish(768119) CCR4-NOT transcription complex, subunit 7
cow(508055) CCR4-NOT transcription complex, subunit 7
domestic cat(101080782) CCR4-NOT transcription complex, subunit 7
dog(482895) CCR4-NOT transcription complex, subunit 7
chicken(422733) CCR4-NOT transcription complex, subunit 7
Goat(100861077) CCR4-NOT transcription complex, subunit 7
sheep(101120985) CCR4-NOT transcription complex, subunit 7
naked mole-rat(101699835) CCR4-NOT transcription complex, subunit 7
domestic guinea pig(100730727) CCR4-NOT transcription complex, subunit 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013354 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013354 Rosetta Predictions human pricing
NM_054026 Rosetta Predictions human pricing
NM_001107313 Rosetta Predictions rat pricing
NM_011135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344676 predicted 772
2 SASI_Hs02_00344677 predicted 491
3 SASI_Hs02_00344678 predicted 570
4 SASI_Hs02_00344679 predicted 496
5 SASI_Hs02_00344680 predicted 484
6 SASI_Hs02_00344681 predicted 697
7 SASI_Hs02_00344682 predicted 488
8 SASI_Hs01_00174066 predicted 765
9 SASI_Hs02_00344683 predicted 398
10 SASI_Hs01_00174067 predicted 766
11 SASI_Hs01_00174068 predicted 754
12 SASI_Hs01_00174069 predicted 1139
13 SASI_Hs01_00174070 predicted 1051
14 SASI_Hs01_00174071 predicted 1088
15 SASI_Hs01_00174072 predicted 1059
16 SASI_Hs01_00174073 predicted 1220
17 SASI_Hs01_00174074 predicted 946
18 SASI_Hs01_00174075 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361959 predicted 775
2 SASI_Hs02_00361960 predicted 493
3 SASI_Hs02_00361961 predicted 571
4 SASI_Hs02_00361962 predicted 492
5 SASI_Hs02_00361963 predicted 480
6 SASI_Hs02_00361964 predicted 698
7 SASI_Hs02_00361965 predicted 492
8 SASI_Hs01_00129246 predicted 769
9 SASI_Hs02_00361966 predicted 406
10 SASI_Hs01_00129247 predicted 769
11 SASI_Hs01_00129248 predicted 761
12 SASI_Hs01_00129249 predicted 1060
13 SASI_Hs01_00129250 predicted 1117
14 SASI_Hs01_00129251 predicted 1134
15 SASI_Hs01_00129252 predicted 1122
16 SASI_Hs01_00129253 predicted 946
17 SASI_Hs01_00129254 predicted 1065
18 SASI_Hs01_00129255 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227605 predicted 610
2 SASI_Rn02_00227606 predicted 764
3 SASI_Rn02_00227607 predicted 625
4 SASI_Rn02_00227608 predicted 1190
5 SASI_Rn02_00227609 predicted 991
6 SASI_Rn02_00227610 predicted 568
7 SASI_Rn02_00227611 predicted 1148
8 SASI_Rn02_00227612 predicted 817
9 SASI_Rn02_00227613 predicted 853
10 SASI_Rn02_00227614 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084858 predicted 1641
2 SASI_Mm01_00084859 predicted 1647
3 SASI_Mm01_00084860 predicted 1483
4 SASI_Mm02_00319963 predicted 1548
5 SASI_Mm02_00319964 predicted 1337
6 SASI_Mm01_00084861 predicted 1857
7 SASI_Mm01_00084862 predicted 1365
8 SASI_Mm02_00319965 predicted 1737
9 SASI_Mm02_00319966 predicted 1185
10 SASI_Mm01_00084863 predicted 1482
11 SASI_Mm01_00084864 predicted 1529
12 SASI_Mm01_00084865 predicted 1450
13 SASI_Mm01_00084866 predicted 1283
14 SASI_Mm01_00084867 predicted 1375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013354
VALIDATED
CNOT7 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-773s21c1
Sequence:CCGGCGGTTACGACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTCGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-471s21c1
Sequence:CCGGGCTGACTATCAATACCAACTACTCGAGTAGTTGGTATTGATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-1053s21c1
Sequence:CCGGGATGCCAAATATTGTGGTCATCTCGAGATGACCACAATATTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-495s21c1
Sequence:CCGGCGGTGTAATGTAGACTTGTTACTCGAGTAACAAGTCTACATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-495s1c1
Sequence:CCGGCGGTGTAATGTAGACTTGTTACTCGAGTAACAAGTCTACATTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013354.4-641s1c1
Sequence:CCGGGCTACTAACAACATCTGGTATCTCGAGATACCAGATGTTGTTAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013354.4-471s1c1
Sequence:CCGGGCTGACTATCAATACCAACTACTCGAGTAGTTGGTATTGATAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-773s1c1
Sequence:CCGGCGGTTACGACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTCGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-1053s1c1
Sequence:CCGGGATGCCAAATATTGTGGTCATCTCGAGATGACCACAATATTTGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013354
VALIDATED
CNOT7 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-773s21c1
Sequence:CCGGCGGTTACGACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTCGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-471s21c1
Sequence:CCGGGCTGACTATCAATACCAACTACTCGAGTAGTTGGTATTGATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-1053s21c1
Sequence:CCGGGATGCCAAATATTGTGGTCATCTCGAGATGACCACAATATTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-495s21c1
Sequence:CCGGCGGTGTAATGTAGACTTGTTACTCGAGTAACAAGTCTACATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-495s1c1
Sequence:CCGGCGGTGTAATGTAGACTTGTTACTCGAGTAACAAGTCTACATTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013354.4-641s1c1
Sequence:CCGGGCTACTAACAACATCTGGTATCTCGAGATACCAGATGTTGTTAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013354.4-471s1c1
Sequence:CCGGGCTGACTATCAATACCAACTACTCGAGTAGTTGGTATTGATAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-773s1c1
Sequence:CCGGCGGTTACGACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTCGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-1053s1c1
Sequence:CCGGGATGCCAAATATTGTGGTCATCTCGAGATGACCACAATATTTGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013354
VALIDATED
CNOT7 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-773s21c1
Sequence:CCGGCGGTTACGACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTCGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-471s21c1
Sequence:CCGGGCTGACTATCAATACCAACTACTCGAGTAGTTGGTATTGATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-1053s21c1
Sequence:CCGGGATGCCAAATATTGTGGTCATCTCGAGATGACCACAATATTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013354.5-495s21c1
Sequence:CCGGCGGTGTAATGTAGACTTGTTACTCGAGTAACAAGTCTACATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-495s1c1
Sequence:CCGGCGGTGTAATGTAGACTTGTTACTCGAGTAACAAGTCTACATTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013354.4-641s1c1
Sequence:CCGGGCTACTAACAACATCTGGTATCTCGAGATACCAGATGTTGTTAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013354.4-471s1c1
Sequence:CCGGGCTGACTATCAATACCAACTACTCGAGTAGTTGGTATTGATAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-773s1c1
Sequence:CCGGCGGTTACGACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTCGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013354.4-1053s1c1
Sequence:CCGGGATGCCAAATATTGTGGTCATCTCGAGATGACCACAATATTTGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011135
VALIDATED
CNOT7 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-2373s1c1
Sequence:CCGGCCTTCTATTCTGCAGTACTTACTCGAGTAAGTACTGCAGAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1371s1c1
Sequence:CCGGGCGGTGTAATGTAGACTTGTTCTCGAGAACAAGTCTACATTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1448s1c1
Sequence:CCGGGAACGTCAACTTGGCAGTTTACTCGAGTAAACTGCCAAGTTGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011135.2-1934s1c1
Sequence:CCGGCCAAATACTGTGGTCACTTATCTCGAGATAAGTGACCACAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1404s1c1
Sequence:CCGGGCTCGGACTGACCTTTATGAACTCGAGTTCATAAAGGTCAGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011135
VALIDATED
CNOT7 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-2373s1c1
Sequence:CCGGCCTTCTATTCTGCAGTACTTACTCGAGTAAGTACTGCAGAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1371s1c1
Sequence:CCGGGCGGTGTAATGTAGACTTGTTCTCGAGAACAAGTCTACATTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1448s1c1
Sequence:CCGGGAACGTCAACTTGGCAGTTTACTCGAGTAAACTGCCAAGTTGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011135.2-1934s1c1
Sequence:CCGGCCAAATACTGTGGTCACTTATCTCGAGATAAGTGACCACAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1404s1c1
Sequence:CCGGGCTCGGACTGACCTTTATGAACTCGAGTTCATAAAGGTCAGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011135
VALIDATED
CNOT7 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-2373s1c1
Sequence:CCGGCCTTCTATTCTGCAGTACTTACTCGAGTAAGTACTGCAGAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1371s1c1
Sequence:CCGGGCGGTGTAATGTAGACTTGTTCTCGAGAACAAGTCTACATTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1448s1c1
Sequence:CCGGGAACGTCAACTTGGCAGTTTACTCGAGTAAACTGCCAAGTTGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011135.2-1934s1c1
Sequence:CCGGCCAAATACTGTGGTCACTTATCTCGAGATAAGTGACCACAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011135.2-1404s1c1
Sequence:CCGGGCTCGGACTGACCTTTATGAACTCGAGTTCATAAAGGTCAGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks