EMAIL THIS PAGE TO A FRIEND

CNOT8

CCR4-NOT transcription complex, subunit 8

85 Gene Product Result for
Synonyms: CAF1 CALIF Caf1b POP2 hCAF1
UniProtKB ID: Q9UFF9, B2RAR8, D3DQI8, O95709, Q7Z521, Q9H6Y1
Gene ID:
Mouse(69125) CCR4-NOT transcription complex, subunit 8
Rat(363603) CCR4-NOT transcription complex, subunit 8
Zebrafish(406788) CCR4-NOT transcription complex, subunit 8
chicken(416255) CCR4-NOT transcription complex, subunit 8
domestic cat(101095951) CCR4-NOT transcription complex, subunit 8
cow(533443) CCR4-NOT transcription complex, subunit 8
dog(489162) CCR4-NOT transcription complex, subunit 8
domestic guinea pig(100728895) CCR4-NOT transcription complex, subunit 8
naked mole-rat(101717232) CCR4-NOT transcription complex, subunit 8
sheep(101109796) CCR4-NOT transcription complex, subunit 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004779 Rosetta Predictions human pricing
NM_001008382 Rosetta Predictions rat pricing
NM_026949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217476 predicted 815
2 SASI_Hs01_00217477 predicted 332
3 SASI_Hs01_00217478 predicted 562
4 SASI_Hs01_00217479 predicted 577
5 SASI_Hs01_00217480 predicted 991
6 SASI_Hs01_00217481 predicted 756
7 SASI_Hs01_00217482 predicted 476
8 SASI_Hs01_00217483 predicted 396
9 SASI_Hs01_00217484 predicted 883
10 SASI_Hs01_00217485 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069503 predicted 940
2 SASI_Rn02_00199158 predicted 349
3 SASI_Rn01_00069504 predicted 420
4 SASI_Rn01_00069505 predicted 537
5 SASI_Rn01_00069506 predicted 951
6 SASI_Rn01_00069507 predicted 963
7 SASI_Rn01_00069508 predicted 857
8 SASI_Rn01_00069509 predicted 660
9 SASI_Rn01_00069510 predicted 550
10 SASI_Rn01_00069511 predicted 620
11 SASI_Rn01_00069512 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068073 predicted 475
2 SASI_Mm01_00068074 predicted 346
3 SASI_Mm01_00068075 predicted 232
4 SASI_Mm01_00068076 predicted 457
5 SASI_Mm01_00068077 predicted 787
6 SASI_Mm01_00068078 predicted 1102
7 SASI_Mm01_00068079 predicted 874
8 SASI_Mm02_00331263 predicted 583
9 SASI_Mm01_00068080 predicted 890
10 SASI_Mm01_00068081 predicted 549
11 SASI_Mm01_00068082 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004779
VALIDATED
CNOT8 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-479s1c1
Sequence:CCGGGCTGGGCCTTACATTCACAAACTCGAGTTTGTGAATGTAAGGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004779.4-2010s1c1
Sequence:CCGGCCACTTCTCTACTCCATTATTCTCGAGAATAATGGAGTAGAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-818s1c1
Sequence:CCGGCCCATCCATTTATGATGTGAACTCGAGTTCACATCATAAATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-947s1c1
Sequence:CCGGGCTGACAGGAATGGCTTTCTTCTCGAGAAGAAAGCCATTCCTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-1100s1c1
Sequence:CCGGCCTGGCGATTATCAACAACATCTCGAGATGTTGTTGATAATCGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-947s21c1
Sequence:CCGGGCTGACAGGAATGGCTTTCTTCTCGAGAAGAAAGCCATTCCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-339s21c1
Sequence:CCGGATCGTGCTCAGTTACAGTTATCTCGAGATAACTGTAACTGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-393s21c1
Sequence:CCGGGTGCGACCAATTGGTGAATTTCTCGAGAAATTCACCAATTGGTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-1092s21c1
Sequence:CCGGATGAGCATCCTGGCGATTATCCTCGAGGATAATCGCCAGGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-1435s21c1
Sequence:CCGGAGTCTGAAACAAAGTAGTAAACTCGAGTTTACTACTTTGTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004779
VALIDATED
CNOT8 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-479s1c1
Sequence:CCGGGCTGGGCCTTACATTCACAAACTCGAGTTTGTGAATGTAAGGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004779.4-2010s1c1
Sequence:CCGGCCACTTCTCTACTCCATTATTCTCGAGAATAATGGAGTAGAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-818s1c1
Sequence:CCGGCCCATCCATTTATGATGTGAACTCGAGTTCACATCATAAATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-947s1c1
Sequence:CCGGGCTGACAGGAATGGCTTTCTTCTCGAGAAGAAAGCCATTCCTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-1100s1c1
Sequence:CCGGCCTGGCGATTATCAACAACATCTCGAGATGTTGTTGATAATCGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-947s21c1
Sequence:CCGGGCTGACAGGAATGGCTTTCTTCTCGAGAAGAAAGCCATTCCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-339s21c1
Sequence:CCGGATCGTGCTCAGTTACAGTTATCTCGAGATAACTGTAACTGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-393s21c1
Sequence:CCGGGTGCGACCAATTGGTGAATTTCTCGAGAAATTCACCAATTGGTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-1092s21c1
Sequence:CCGGATGAGCATCCTGGCGATTATCCTCGAGGATAATCGCCAGGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-1435s21c1
Sequence:CCGGAGTCTGAAACAAAGTAGTAAACTCGAGTTTACTACTTTGTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004779
VALIDATED
CNOT8 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-479s1c1
Sequence:CCGGGCTGGGCCTTACATTCACAAACTCGAGTTTGTGAATGTAAGGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004779.4-2010s1c1
Sequence:CCGGCCACTTCTCTACTCCATTATTCTCGAGAATAATGGAGTAGAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-818s1c1
Sequence:CCGGCCCATCCATTTATGATGTGAACTCGAGTTCACATCATAAATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-947s1c1
Sequence:CCGGGCTGACAGGAATGGCTTTCTTCTCGAGAAGAAAGCCATTCCTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004779.4-1100s1c1
Sequence:CCGGCCTGGCGATTATCAACAACATCTCGAGATGTTGTTGATAATCGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-947s21c1
Sequence:CCGGGCTGACAGGAATGGCTTTCTTCTCGAGAAGAAAGCCATTCCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-339s21c1
Sequence:CCGGATCGTGCTCAGTTACAGTTATCTCGAGATAACTGTAACTGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-393s21c1
Sequence:CCGGGTGCGACCAATTGGTGAATTTCTCGAGAAATTCACCAATTGGTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-1092s21c1
Sequence:CCGGATGAGCATCCTGGCGATTATCCTCGAGGATAATCGCCAGGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004779.4-1435s21c1
Sequence:CCGGAGTCTGAAACAAAGTAGTAAACTCGAGTTTACTACTTTGTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026949
VALIDATED
CNOT8 MISSION shRNA Bacterial Glycerol Stock
CCR4-NOT transcription complex, subunit 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-718s1c1
Sequence:CCGGCCGTCCATTTACGATGTGAAACTCGAGTTTCACATCGTAAATGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026949.2-1815s1c1
Sequence:CCGGCCACAGAAAGAAAGGACAATTCTCGAGAATTGTCCTTTCTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-346s1c1
Sequence:CCGGCGGTGCAATGTTGATCTTCTTCTCGAGAAGAAGATCAACATTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-316s1c1
Sequence:CCGGAGCTCCATAGATTACCAGTATCTCGAGATACTGGTAATCTATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-719s1c1
Sequence:CCGGCGTCCATTTACGATGTGAAATCTCGAGATTTCACATCGTAAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026949.3-1770s21c1
Sequence:CCGGGTGCTTAAGGTTAGGCATTTACTCGAGTAAATGCCTAACCTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-897s21c1
Sequence:CCGGTATTGACGATGCCAAGTATTGCTCGAGCAATACTTGGCATCGTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-553s21c1
Sequence:CCGGCACTTTGCAGAGCTGCTTATGCTCGAGCATAAGCAGCTCTGCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-292s21c1
Sequence:CCGGGTACGGCCGATCGGTGAATTTCTCGAGAAATTCACCGATCGGCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-221s21c1
Sequence:CCGGTGCGGAAGATCCGTGAGATTGCTCGAGCAATCTCACGGATCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026949
VALIDATED
CNOT8 MISSION shRNA shRNA Plasmid DNA
CCR4-NOT transcription complex, subunit 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-718s1c1
Sequence:CCGGCCGTCCATTTACGATGTGAAACTCGAGTTTCACATCGTAAATGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026949.2-1815s1c1
Sequence:CCGGCCACAGAAAGAAAGGACAATTCTCGAGAATTGTCCTTTCTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-346s1c1
Sequence:CCGGCGGTGCAATGTTGATCTTCTTCTCGAGAAGAAGATCAACATTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-316s1c1
Sequence:CCGGAGCTCCATAGATTACCAGTATCTCGAGATACTGGTAATCTATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-719s1c1
Sequence:CCGGCGTCCATTTACGATGTGAAATCTCGAGATTTCACATCGTAAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026949.3-1770s21c1
Sequence:CCGGGTGCTTAAGGTTAGGCATTTACTCGAGTAAATGCCTAACCTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-897s21c1
Sequence:CCGGTATTGACGATGCCAAGTATTGCTCGAGCAATACTTGGCATCGTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-553s21c1
Sequence:CCGGCACTTTGCAGAGCTGCTTATGCTCGAGCATAAGCAGCTCTGCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-292s21c1
Sequence:CCGGGTACGGCCGATCGGTGAATTTCTCGAGAAATTCACCGATCGGCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-221s21c1
Sequence:CCGGTGCGGAAGATCCGTGAGATTGCTCGAGCAATCTCACGGATCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026949
VALIDATED
CNOT8 MISSION shRNA Lentiviral Transduction Particles
CCR4-NOT transcription complex, subunit 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-718s1c1
Sequence:CCGGCCGTCCATTTACGATGTGAAACTCGAGTTTCACATCGTAAATGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026949.2-1815s1c1
Sequence:CCGGCCACAGAAAGAAAGGACAATTCTCGAGAATTGTCCTTTCTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-346s1c1
Sequence:CCGGCGGTGCAATGTTGATCTTCTTCTCGAGAAGAAGATCAACATTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-316s1c1
Sequence:CCGGAGCTCCATAGATTACCAGTATCTCGAGATACTGGTAATCTATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026949.2-719s1c1
Sequence:CCGGCGTCCATTTACGATGTGAAATCTCGAGATTTCACATCGTAAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026949.3-1770s21c1
Sequence:CCGGGTGCTTAAGGTTAGGCATTTACTCGAGTAAATGCCTAACCTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-897s21c1
Sequence:CCGGTATTGACGATGCCAAGTATTGCTCGAGCAATACTTGGCATCGTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-553s21c1
Sequence:CCGGCACTTTGCAGAGCTGCTTATGCTCGAGCATAAGCAGCTCTGCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-292s21c1
Sequence:CCGGGTACGGCCGATCGGTGAATTTCTCGAGAAATTCACCGATCGGCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026949.3-221s21c1
Sequence:CCGGTGCGGAAGATCCGTGAGATTGCTCGAGCAATCTCACGGATCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks