EMAIL THIS PAGE TO A FRIEND

CNP

2',3'-cyclic nucleotide 3' phosphodiesterase

Synonyms: CNP1
UniProtKB ID: P09543
Gene ID:
Mouse(12799) 2',3'-cyclic nucleotide 3' phosphodiesterase
Rat(25275) 2',3'-cyclic nucleotide 3' phosphodiesterase
sheep(101120423) 2',3'-cyclic nucleotide 3' phosphodiesterase
naked mole-rat(101703085) 2',3'-cyclic nucleotide 3' phosphodiesterase
domestic guinea pig(100715967) 2',3'-cyclic nucleotide 3' phosphodiesterase
Zebrafish(325896) 2',3'-cyclic nucleotide 3' phosphodiesterase
cow(280752) 2',3'-cyclic nucleotide 3' phosphodiesterase
Horse(100066401) 2',3'-cyclic nucleotide 3' phosphodiesterase
domestic cat(101093220) 2',3'-cyclic nucleotide 3' phosphodiesterase
dog(607694) 2',3'-cyclic nucleotide 3' phosphodiesterase
chicken(395921) 2',3'-cyclic nucleotide 3' phosphodiesterase
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405637 Anti-CNP antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
AV33880 Anti-CNP antibody produced in rabbit IgG fraction of antiserum human, rat, horse, bovine
western blot pricing
HPA023266 Anti-CNP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry, western blot pricing
HPA023278 Anti-CNP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry, western blot pricing
HPA023280 Anti-CNP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA023338 Anti-CNP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab4 mouse, human
immunohistochemistry, western blot pricing
SAB2100458 Anti-CNP antibody produced in rabbit affinity isolated antibody rat, rabbit, human, mouse, horse
western blot pricing
C9743 Anti-CNPase antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
flow cytometry, immunohistochemistry, western blot pricing
SAB1402730 Monoclonal Anti-CNP antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
AMAB91068 Monoclonal Anti-CNP antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2871, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
AMAB91069 Monoclonal Anti-CNP antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2872, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
AMAB91072 Monoclonal Anti-CNP antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2887, purified immunoglobulin, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing
C5922 Monoclonal Anti-CNPase antibody produced in mouse clone 11-5B, ascites fluid canine, pig, sheep, human, mouse, bovine, rat, rabbit
ELISA, immunohistochemistry, microarray, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0274 AQUA Peptide TLFIL[R] cow, dog, human, mouse, rat pricing
AQ0275 AQUA Peptide GGSQGEEVGELP[R] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033133 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156031 MISSION® esiRNA esiRNA human CNP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033133 Rosetta Predictions human pricing
NM_012809 Rosetta Predictions rat pricing
NM_009923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148262 predicted 707
2 SASI_Hs01_00148263 predicted 1071
3 SASI_Hs01_00148264 predicted 1170
4 SASI_Hs01_00148265 predicted 851
5 SASI_Hs01_00148266 predicted 942
6 SASI_Hs01_00148267 predicted 1037
7 SASI_Hs01_00148268 predicted 1062
8 SASI_Hs01_00148269 predicted 950
9 SASI_Hs01_00148270 predicted 854
10 SASI_Hs01_00148271 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048455 predicted 619
2 SASI_Rn01_00048456 predicted 791
3 SASI_Rn01_00048457 predicted 888
4 SASI_Rn01_00048458 predicted 1785
5 SASI_Rn01_00048459 predicted 196
6 SASI_Rn01_00048460 predicted 739
7 SASI_Rn01_00048461 predicted 818
8 SASI_Rn01_00048462 predicted 895
9 SASI_Rn01_00048463 predicted 882
10 SASI_Rn01_00048464 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173176 predicted 1639
2 SASI_Mm01_00173177 predicted 382
3 SASI_Mm01_00173178 predicted 1820
4 SASI_Mm01_00173179 predicted 740
5 SASI_Mm01_00173180 predicted 910
6 SASI_Mm02_00317463 predicted 1816
7 SASI_Mm01_00173181 predicted 752
8 SASI_Mm01_00173182 predicted 676
9 SASI_Mm02_00317464 predicted 1814
10 SASI_Mm01_00173183 predicted 834
11 SASI_Mm01_00173184 predicted 909
12 SASI_Mm01_00173185 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009923
VALIDATED
CNP MISSION shRNA Bacterial Glycerol Stock
2',3'-cyclic nucleotide 3' phosphodiesterase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009923.2-475s21c1
Sequence:CCGGGGTTCTTGTGCTTGATGATACCTCGAGGTATCATCAAGCACAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009923.2-1746s21c1
Sequence:CCGGTGCCACATGCTAGGGACAAACCTCGAGGTTTGTCCCTAGCATGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009923.2-1158s21c1
Sequence:CCGGGTCTTGACCTCTTAGATATTTCTCGAGAAATATCTAAGAGGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-1636s1c1
Sequence:CCGGCCCAGATGCATCCAAGAACTTCTCGAGAAGTTCTTGGATGCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009923.1-758s1c1
Sequence:CCGGCGACACTTTATTTCTGGAGATCTCGAGATCTCCAGAAATAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-337s1c1
Sequence:CCGGCGCTGATGCTTACAAGATCATCTCGAGATGATCTTGTAAGCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009923.1-1240s1c1
Sequence:CCGGGACTAAGAAGATGGAGGTCAACTCGAGTTGACCTCCATCTTCTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-232s1c1
Sequence:CCGGCGAGTGCAAGACGCTATTCATCTCGAGATGAATAGCGTCTTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009923
VALIDATED
CNP MISSION shRNA shRNA Plasmid DNA
2',3'-cyclic nucleotide 3' phosphodiesterase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009923.2-475s21c1
Sequence:CCGGGGTTCTTGTGCTTGATGATACCTCGAGGTATCATCAAGCACAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009923.2-1746s21c1
Sequence:CCGGTGCCACATGCTAGGGACAAACCTCGAGGTTTGTCCCTAGCATGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009923.2-1158s21c1
Sequence:CCGGGTCTTGACCTCTTAGATATTTCTCGAGAAATATCTAAGAGGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-1636s1c1
Sequence:CCGGCCCAGATGCATCCAAGAACTTCTCGAGAAGTTCTTGGATGCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009923.1-758s1c1
Sequence:CCGGCGACACTTTATTTCTGGAGATCTCGAGATCTCCAGAAATAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-337s1c1
Sequence:CCGGCGCTGATGCTTACAAGATCATCTCGAGATGATCTTGTAAGCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009923.1-1240s1c1
Sequence:CCGGGACTAAGAAGATGGAGGTCAACTCGAGTTGACCTCCATCTTCTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-232s1c1
Sequence:CCGGCGAGTGCAAGACGCTATTCATCTCGAGATGAATAGCGTCTTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009923
VALIDATED
CNP MISSION shRNA Lentiviral Transduction Particles
2',3'-cyclic nucleotide 3' phosphodiesterase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009923.2-475s21c1
Sequence:CCGGGGTTCTTGTGCTTGATGATACCTCGAGGTATCATCAAGCACAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009923.2-1746s21c1
Sequence:CCGGTGCCACATGCTAGGGACAAACCTCGAGGTTTGTCCCTAGCATGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009923.2-1158s21c1
Sequence:CCGGGTCTTGACCTCTTAGATATTTCTCGAGAAATATCTAAGAGGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-1636s1c1
Sequence:CCGGCCCAGATGCATCCAAGAACTTCTCGAGAAGTTCTTGGATGCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009923.1-758s1c1
Sequence:CCGGCGACACTTTATTTCTGGAGATCTCGAGATCTCCAGAAATAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-337s1c1
Sequence:CCGGCGCTGATGCTTACAAGATCATCTCGAGATGATCTTGTAAGCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009923.1-1240s1c1
Sequence:CCGGGACTAAGAAGATGGAGGTCAACTCGAGTTGACCTCCATCTTCTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009923.1-232s1c1
Sequence:CCGGCGAGTGCAAGACGCTATTCATCTCGAGATGAATAGCGTCTTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033133
VALIDATED
CNP MISSION shRNA Bacterial Glycerol Stock
2',3'-cyclic nucleotide 3' phosphodiesterase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-695s21c1
Sequence:CCGGACTTCCTGCCGCTCTACTTCGCTCGAGCGAAGTAGAGCGGCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-1042s21c1
Sequence:CCGGGTGGAGTTAAGCGAGCAGCAACTCGAGTTGCTGCTCGCTTAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-1411s21c1
Sequence:CCGGGTGTTCTCACCACCACTTATGCTCGAGCATAAGTGGTGGTGAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-801s21c1
Sequence:CCGGCAAGAAGGAGCTGCGACAATTCTCGAGAATTGTCGCAGCTCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-354s21c1
Sequence:CCGGCGTGGACAAGTACCGTGATGGCTCGAGCCATCACGGTACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-1010s1c1
Sequence:CCGGGTGGAGTTAAGCGAGCAGCAACTCGAGTTGCTGCTCGCTTAACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033133.x-879s1c1
Sequence:CCGGTTTGTGACTACGGGAAGGCTCCTCGAGGAGCCTTCCCGTAGTCACAAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-322s1c1
Sequence:CCGGCGTGGACAAGTACCGTGATGGCTCGAGCCATCACGGTACTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-663s1c1
Sequence:CCGGACTTCCTGCCGCTCTACTTCGCTCGAGCGAAGTAGAGCGGCAGGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033133.x-479s1c1
Sequence:CCGGGACACCAACCACGAACGGGAACTCGAGTTCCCGTTCGTGGTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033133
VALIDATED
CNP MISSION shRNA shRNA Plasmid DNA
2',3'-cyclic nucleotide 3' phosphodiesterase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-695s21c1
Sequence:CCGGACTTCCTGCCGCTCTACTTCGCTCGAGCGAAGTAGAGCGGCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-1042s21c1
Sequence:CCGGGTGGAGTTAAGCGAGCAGCAACTCGAGTTGCTGCTCGCTTAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-1411s21c1
Sequence:CCGGGTGTTCTCACCACCACTTATGCTCGAGCATAAGTGGTGGTGAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-801s21c1
Sequence:CCGGCAAGAAGGAGCTGCGACAATTCTCGAGAATTGTCGCAGCTCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-354s21c1
Sequence:CCGGCGTGGACAAGTACCGTGATGGCTCGAGCCATCACGGTACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-1010s1c1
Sequence:CCGGGTGGAGTTAAGCGAGCAGCAACTCGAGTTGCTGCTCGCTTAACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033133.x-879s1c1
Sequence:CCGGTTTGTGACTACGGGAAGGCTCCTCGAGGAGCCTTCCCGTAGTCACAAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-322s1c1
Sequence:CCGGCGTGGACAAGTACCGTGATGGCTCGAGCCATCACGGTACTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-663s1c1
Sequence:CCGGACTTCCTGCCGCTCTACTTCGCTCGAGCGAAGTAGAGCGGCAGGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033133.x-479s1c1
Sequence:CCGGGACACCAACCACGAACGGGAACTCGAGTTCCCGTTCGTGGTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033133
VALIDATED
CNP MISSION shRNA Lentiviral Transduction Particles
2',3'-cyclic nucleotide 3' phosphodiesterase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-695s21c1
Sequence:CCGGACTTCCTGCCGCTCTACTTCGCTCGAGCGAAGTAGAGCGGCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-1042s21c1
Sequence:CCGGGTGGAGTTAAGCGAGCAGCAACTCGAGTTGCTGCTCGCTTAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-1411s21c1
Sequence:CCGGGTGTTCTCACCACCACTTATGCTCGAGCATAAGTGGTGGTGAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-801s21c1
Sequence:CCGGCAAGAAGGAGCTGCGACAATTCTCGAGAATTGTCGCAGCTCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033133.4-354s21c1
Sequence:CCGGCGTGGACAAGTACCGTGATGGCTCGAGCCATCACGGTACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-1010s1c1
Sequence:CCGGGTGGAGTTAAGCGAGCAGCAACTCGAGTTGCTGCTCGCTTAACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033133.x-879s1c1
Sequence:CCGGTTTGTGACTACGGGAAGGCTCCTCGAGGAGCCTTCCCGTAGTCACAAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-322s1c1
Sequence:CCGGCGTGGACAAGTACCGTGATGGCTCGAGCCATCACGGTACTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033133.x-663s1c1
Sequence:CCGGACTTCCTGCCGCTCTACTTCGCTCGAGCGAAGTAGAGCGGCAGGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033133.x-479s1c1
Sequence:CCGGGACACCAACCACGAACGGGAACTCGAGTTCCCGTTCGTGGTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks