EMAIL THIS PAGE TO A FRIEND

CNPPD1

cyclin Pas1/PHO80 domain containing 1

Synonyms: C2orf24 CGI-57
UniProtKB ID: Q9BV87, B2RC77, O75548, Q9H4N0, Q9UQN0
Gene ID:
Mouse(69171) cyclin Pas1/PHO80 domain containing 1
Rat(316530) cyclin Pas1/PHO80 domain containing 1
sheep(101112796) cyclin Pas1/PHO80 domain containing 1
domestic guinea pig(100712799) cyclin Pas1/PHO80 domain containing 1
naked mole-rat(101726110) cyclin Pas1/PHO80 domain containing 1
Zebrafish(334868) cyclin Pas1/PHO80 domain containing 1
chicken(424204) cyclin Pas1/PHO80 domain containing 1
cow(507473) cyclin Pas1/PHO80 domain containing 1
domestic cat(101093793) cyclin Pas1/PHO80 domain containing 1
dog(610574) cyclin Pas1/PHO80 domain containing 1
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015680 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060501 MISSION® esiRNA esiRNA human C2orf24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015680 Rosetta Predictions human pricing
NM_199112 Rosetta Predictions rat pricing
NM_026977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209206 predicted 487
2 SASI_Hs01_00209207 predicted 1592
3 SASI_Hs01_00209209 predicted 843
4 SASI_Hs01_00209210 predicted 526
5 SASI_Hs01_00209211 predicted 834
6 SASI_Hs01_00209212 predicted 541
7 SASI_Hs01_00209214 predicted 1622
8 SASI_Hs01_00209215 predicted 1691
9 SASI_Hs02_00348330 predicted 659
10 SASI_Hs02_00348331 predicted 491
11 SASI_Hs01_00209208 predicted 320
12 SASI_Hs01_00209213 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075321 predicted 639
2 SASI_Rn01_00075322 predicted 681
3 SASI_Rn01_00075323 predicted 524
4 SASI_Rn01_00075324 predicted 1003
5 SASI_Rn01_00075325 predicted 1784
6 SASI_Rn01_00075326 predicted 700
7 SASI_Rn01_00075327 predicted 1655
8 SASI_Rn01_00075328 predicted 1210
9 SASI_Rn01_00075329 predicted 586
10 SASI_Rn02_00270135 predicted 1343
11 SASI_Rn01_00075320 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114381 predicted 1020
2 SASI_Mm01_00114382 predicted 698
3 SASI_Mm01_00114383 predicted 859
4 SASI_Mm02_00331298 predicted 536
5 SASI_Mm01_00114385 predicted 1223
6 SASI_Mm01_00114386 predicted 659
7 SASI_Mm01_00114388 predicted 711
8 SASI_Mm01_00114389 predicted 1373
9 SASI_Mm02_00331299 predicted 702
10 SASI_Mm01_00114390 predicted 416
11 SASI_Mm01_00114384 predicted 550
12 SASI_Mm01_00114387 predicted 1524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015680
CNPPD1 MISSION shRNA Bacterial Glycerol Stock
cyclin Pas1/PHO80 domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-1339s1c1
Sequence:CCGGCTCGCCTCAAGTCTTTCGTTTCTCGAGAAACGAAAGACTTGAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-822s1c1
Sequence:CCGGGTAAAGCTGTCTTGCCTGTTACTCGAGTAACAGGCAAGACAGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137206    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015680.3-1692s1c1
Sequence:CCGGGAAGAGTATAGGTGGGAGATACTCGAGTATCTCCCACCTATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015680.3-482s1c1
Sequence:CCGGGCATGTGTCATCCTCTGACTTCTCGAGAAGTCAGAGGATGACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015680.3-1524s1c1
Sequence:CCGGGAAGGTAATTCACTCCTAGATCTCGAGATCTAGGAGTGAATTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-369s1c1
Sequence:CCGGCAGAAGAAATACGTAGCTCATCTCGAGATGAGCTACGTATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015680.3-368s1c1
Sequence:CCGGCCAGAAGAAATACGTAGCTCACTCGAGTGAGCTACGTATTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-979s1c1
Sequence:CCGGGCATACCTTCTGTGCCACAATCTCGAGATTGTGGCACAGAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015680
CNPPD1 MISSION shRNA shRNA Plasmid DNA
cyclin Pas1/PHO80 domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-1339s1c1
Sequence:CCGGCTCGCCTCAAGTCTTTCGTTTCTCGAGAAACGAAAGACTTGAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-822s1c1
Sequence:CCGGGTAAAGCTGTCTTGCCTGTTACTCGAGTAACAGGCAAGACAGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137206    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015680.3-1692s1c1
Sequence:CCGGGAAGAGTATAGGTGGGAGATACTCGAGTATCTCCCACCTATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015680.3-482s1c1
Sequence:CCGGGCATGTGTCATCCTCTGACTTCTCGAGAAGTCAGAGGATGACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015680.3-1524s1c1
Sequence:CCGGGAAGGTAATTCACTCCTAGATCTCGAGATCTAGGAGTGAATTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-369s1c1
Sequence:CCGGCAGAAGAAATACGTAGCTCATCTCGAGATGAGCTACGTATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015680.3-368s1c1
Sequence:CCGGCCAGAAGAAATACGTAGCTCACTCGAGTGAGCTACGTATTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-979s1c1
Sequence:CCGGGCATACCTTCTGTGCCACAATCTCGAGATTGTGGCACAGAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015680
CNPPD1 MISSION shRNA Lentiviral Transduction Particles
cyclin Pas1/PHO80 domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-1339s1c1
Sequence:CCGGCTCGCCTCAAGTCTTTCGTTTCTCGAGAAACGAAAGACTTGAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-822s1c1
Sequence:CCGGGTAAAGCTGTCTTGCCTGTTACTCGAGTAACAGGCAAGACAGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137206    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015680.3-1692s1c1
Sequence:CCGGGAAGAGTATAGGTGGGAGATACTCGAGTATCTCCCACCTATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015680.3-482s1c1
Sequence:CCGGGCATGTGTCATCCTCTGACTTCTCGAGAAGTCAGAGGATGACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015680.3-1524s1c1
Sequence:CCGGGAAGGTAATTCACTCCTAGATCTCGAGATCTAGGAGTGAATTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-369s1c1
Sequence:CCGGCAGAAGAAATACGTAGCTCATCTCGAGATGAGCTACGTATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015680.3-368s1c1
Sequence:CCGGCCAGAAGAAATACGTAGCTCACTCGAGTGAGCTACGTATTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015680.3-979s1c1
Sequence:CCGGGCATACCTTCTGTGCCACAATCTCGAGATTGTGGCACAGAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026977
VALIDATED
CNPPD1 MISSION shRNA Bacterial Glycerol Stock
cyclin Pas1/PHO80 domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026977.1-2292s1c1
Sequence:CCGGGCTGCTTTAGAACTTCCTAATCTCGAGATTAGGAAGTTCTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026977.1-678s1c1
Sequence:CCGGCGTGTCGTCTTCTGATTTGTTCTCGAGAACAAATCAGAAGACGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026977.1-718s1c1
Sequence:CCGGGCCAGTAAATACCTTTATGATCTCGAGATCATAAAGGTATTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026977.1-1069s1c1
Sequence:CCGGGTAGCATCAGTGGCTGTAATACTCGAGTATTACAGCCACTGATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026977.1-505s1c1
Sequence:CCGGGCAGACATTACTGTGGAACTTCTCGAGAAGTTCCACAGTAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026977.2-1837s21c1
Sequence:CCGGCACGCCTAGGGAAGTAGATTTCTCGAGAAATCTACTTCCCTAGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026977.2-1385s21c1
Sequence:CCGGCTAACCAAACGGTGTCTATTGCTCGAGCAATAGACACCGTTTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026977
VALIDATED
CNPPD1 MISSION shRNA shRNA Plasmid DNA
cyclin Pas1/PHO80 domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026977.1-2292s1c1
Sequence:CCGGGCTGCTTTAGAACTTCCTAATCTCGAGATTAGGAAGTTCTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026977.1-678s1c1
Sequence:CCGGCGTGTCGTCTTCTGATTTGTTCTCGAGAACAAATCAGAAGACGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026977.1-718s1c1
Sequence:CCGGGCCAGTAAATACCTTTATGATCTCGAGATCATAAAGGTATTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026977.1-1069s1c1
Sequence:CCGGGTAGCATCAGTGGCTGTAATACTCGAGTATTACAGCCACTGATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026977.1-505s1c1
Sequence:CCGGGCAGACATTACTGTGGAACTTCTCGAGAAGTTCCACAGTAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026977.2-1837s21c1
Sequence:CCGGCACGCCTAGGGAAGTAGATTTCTCGAGAAATCTACTTCCCTAGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026977.2-1385s21c1
Sequence:CCGGCTAACCAAACGGTGTCTATTGCTCGAGCAATAGACACCGTTTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026977
VALIDATED
CNPPD1 MISSION shRNA Lentiviral Transduction Particles
cyclin Pas1/PHO80 domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026977.1-2292s1c1
Sequence:CCGGGCTGCTTTAGAACTTCCTAATCTCGAGATTAGGAAGTTCTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026977.1-678s1c1
Sequence:CCGGCGTGTCGTCTTCTGATTTGTTCTCGAGAACAAATCAGAAGACGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026977.1-718s1c1
Sequence:CCGGGCCAGTAAATACCTTTATGATCTCGAGATCATAAAGGTATTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026977.1-1069s1c1
Sequence:CCGGGTAGCATCAGTGGCTGTAATACTCGAGTATTACAGCCACTGATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026977.1-505s1c1
Sequence:CCGGGCAGACATTACTGTGGAACTTCTCGAGAAGTTCCACAGTAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026977.2-1837s21c1
Sequence:CCGGCACGCCTAGGGAAGTAGATTTCTCGAGAAATCTACTTCCCTAGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026977.2-1385s21c1
Sequence:CCGGCTAACCAAACGGTGTCTATTGCTCGAGCAATAGACACCGTTTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks