EMAIL THIS PAGE TO A FRIEND

CNPY1

canopy FGF signaling regulator 1

40 Gene Product Result for
UniProtKB ID: Q3B7I2, A6NGX3
Gene ID:
Human(285888) Summary: Cnpy1 is expressed in the midbrain-hindbrain (MHB) boundary in zebrafish, binds FGFR1 (MIM 136350), and plays a role in FGF signaling (Hirate and Okamoto, 2006 [PubMed 16488878]
Mouse(269637) canopy 1 homolog (zebrafish)
Rat(685001) canopy FGF signaling regulator 1
cow(100336047) canopy 1 homolog (zebrafish)
dog(100683075) canopy 1 homolog (zebrafish)
naked mole-rat(101721308) canopy 1 homolog (zebrafish)
domestic guinea pig(100718396) canopy 1 homolog (zebrafish)
sheep(101106678) canopy 1 homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_379979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379979 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149101 MISSION® esiRNA esiRNA human CNPY1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103176 Rosetta Predictions human pricing
XM_001061855 Rosetta Predictions rat pricing
NM_175651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323663 predicted 859
2 SASI_Hs02_00323664 predicted 842
3 SASI_Hs02_00323665 predicted 897
4 SASI_Hs02_00323666 predicted 342
5 SASI_Hs02_00323667 predicted 620
6 SASI_Hs02_00323668 predicted 402
7 SASI_Hs02_00323669 predicted 671
8 SASI_Hs02_00323670 predicted 275
9 SASI_Hs02_00323671 predicted 309
10 SASI_Hs02_00323672 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301524 predicted 1704
2 SASI_Rn02_00301525 predicted 1837
3 SASI_Rn02_00301526 predicted 1773
4 SASI_Rn02_00301527 predicted 1036
5 SASI_Rn02_00301528 predicted 1199
6 SASI_Rn02_00301529 predicted 1508
7 SASI_Rn02_00301530 predicted 1049
8 SASI_Rn02_00301531 predicted 1574
9 SASI_Rn02_00301532 predicted 1765
10 SASI_Rn02_00301533 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194965 predicted 1214
2 SASI_Mm01_00194966 predicted 957
3 SASI_Mm01_00194967 predicted 787
4 SASI_Mm01_00194968 predicted 840
5 SASI_Mm01_00194969 predicted 382
6 SASI_Mm01_00194972 predicted 413
7 SASI_Mm02_00346597 predicted 1030
8 SASI_Mm02_00346598 predicted 843
9 SASI_Mm02_00346599 predicted 432
10 SASI_Mm01_00194974 predicted 693
11 SASI_Mm01_00194970 predicted 1120
12 SASI_Mm01_00194971 predicted 803
13 SASI_Mm01_00194973 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175651
CNPY1 MISSION shRNA Bacterial Glycerol Stock
canopy FGF signaling regulator 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-698s21c1
Sequence:CCGGGCTTGACTTTACCACTGATTTCTCGAGAAATCAGTGGTAAAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-417s21c1
Sequence:CCGGGGCAAACCATCTAGCTGATATCTCGAGATATCAGCTAGATGGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175651.4-1625s1c1
Sequence:CCGGCTAGGTGTACGTCAGATATTACTCGAGTAATATCTGACGTACACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175651.4-1623s21c1
Sequence:CCGGAGCTAGGTGTACGTCAGATATCTCGAGATATCTGACGTACACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-246s21c1
Sequence:CCGGAGTGACCAAGCAGAAGTATTTCTCGAGAAATACTTCTGCTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-387s21c1
Sequence:CCGGAGATGAGATATTCGAACTTATCTCGAGATAAGTTCGAATATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-428s1c1
Sequence:CCGGCTAGCTGATATGCTGTGCAATCTCGAGATTGCACAGCATATCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-431s1c1
Sequence:CCGGGCTGATATGCTGTGCAATGAACTCGAGTTCATTGCACAGCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-386s1c1
Sequence:CCGGGAAGATGAGATATTCGAACTTCTCGAGAAGTTCGAATATCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175651
CNPY1 MISSION shRNA shRNA Plasmid DNA
canopy FGF signaling regulator 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-698s21c1
Sequence:CCGGGCTTGACTTTACCACTGATTTCTCGAGAAATCAGTGGTAAAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-417s21c1
Sequence:CCGGGGCAAACCATCTAGCTGATATCTCGAGATATCAGCTAGATGGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175651.4-1625s1c1
Sequence:CCGGCTAGGTGTACGTCAGATATTACTCGAGTAATATCTGACGTACACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175651.4-1623s21c1
Sequence:CCGGAGCTAGGTGTACGTCAGATATCTCGAGATATCTGACGTACACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-246s21c1
Sequence:CCGGAGTGACCAAGCAGAAGTATTTCTCGAGAAATACTTCTGCTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-387s21c1
Sequence:CCGGAGATGAGATATTCGAACTTATCTCGAGATAAGTTCGAATATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-428s1c1
Sequence:CCGGCTAGCTGATATGCTGTGCAATCTCGAGATTGCACAGCATATCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-431s1c1
Sequence:CCGGGCTGATATGCTGTGCAATGAACTCGAGTTCATTGCACAGCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-386s1c1
Sequence:CCGGGAAGATGAGATATTCGAACTTCTCGAGAAGTTCGAATATCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175651
CNPY1 MISSION shRNA Lentiviral Transduction Particles
canopy FGF signaling regulator 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-698s21c1
Sequence:CCGGGCTTGACTTTACCACTGATTTCTCGAGAAATCAGTGGTAAAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-417s21c1
Sequence:CCGGGGCAAACCATCTAGCTGATATCTCGAGATATCAGCTAGATGGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175651.4-1625s1c1
Sequence:CCGGCTAGGTGTACGTCAGATATTACTCGAGTAATATCTGACGTACACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175651.4-1623s21c1
Sequence:CCGGAGCTAGGTGTACGTCAGATATCTCGAGATATCTGACGTACACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-246s21c1
Sequence:CCGGAGTGACCAAGCAGAAGTATTTCTCGAGAAATACTTCTGCTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175651.4-387s21c1
Sequence:CCGGAGATGAGATATTCGAACTTATCTCGAGATAAGTTCGAATATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-428s1c1
Sequence:CCGGCTAGCTGATATGCTGTGCAATCTCGAGATTGCACAGCATATCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-431s1c1
Sequence:CCGGGCTGATATGCTGTGCAATGAACTCGAGTTCATTGCACAGCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175651.2-386s1c1
Sequence:CCGGGAAGATGAGATATTCGAACTTCTCGAGAAGTTCGAATATCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379979
CNPY1 MISSION shRNA Bacterial Glycerol Stock
canopy FGF signaling regulator 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-214s1c1
Sequence:CCGGCAAGAGATTCGCTCCTAGGAACTCGAGTTCCTAGGAGCGAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-198s1c1
Sequence:CCGGCGAAGGAGAGAACTTTCAAGACTCGAGTCTTGAAAGTTCTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-196s1c1
Sequence:CCGGGACGAAGGAGAGAACTTTCAACTCGAGTTGAAAGTTCTCTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-293s1c1
Sequence:CCGGCCTTTGAAATTTGCGTGTGAACTCGAGTTCACACGCAAATTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379979.1-485s1c1
Sequence:CCGGCAAAGGTCAATGTCTGCATTTCTCGAGAAATGCAGACATTGACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379979.1-281s1c1
Sequence:CCGGGATGCTTACAGACCTTTGAAACTCGAGTTTCAAAGGTCTGTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-1666s1c1
Sequence:CCGGCCCACCTAAACTCTGATTAAACTCGAGTTTAATCAGAGTTTAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-820s1c1
Sequence:CCGGGCTGTCTGATAAGAACTGGATCTCGAGATCCAGTTCTTATCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-484s1c1
Sequence:CCGGCCAAAGGTCAATGTCTGCATTCTCGAGAATGCAGACATTGACCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-359s1c1
Sequence:CCGGCAGGAGACACACTATCTAGCTCTCGAGAGCTAGATAGTGTGTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379979.1-210s1c1
Sequence:CCGGCTTTCAAGAGATTCGCTCCTACTCGAGTAGGAGCGAATCTCTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379979
CNPY1 MISSION shRNA shRNA Plasmid DNA
canopy FGF signaling regulator 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-214s1c1
Sequence:CCGGCAAGAGATTCGCTCCTAGGAACTCGAGTTCCTAGGAGCGAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-198s1c1
Sequence:CCGGCGAAGGAGAGAACTTTCAAGACTCGAGTCTTGAAAGTTCTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-196s1c1
Sequence:CCGGGACGAAGGAGAGAACTTTCAACTCGAGTTGAAAGTTCTCTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-293s1c1
Sequence:CCGGCCTTTGAAATTTGCGTGTGAACTCGAGTTCACACGCAAATTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379979.1-485s1c1
Sequence:CCGGCAAAGGTCAATGTCTGCATTTCTCGAGAAATGCAGACATTGACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379979.1-281s1c1
Sequence:CCGGGATGCTTACAGACCTTTGAAACTCGAGTTTCAAAGGTCTGTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-1666s1c1
Sequence:CCGGCCCACCTAAACTCTGATTAAACTCGAGTTTAATCAGAGTTTAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-820s1c1
Sequence:CCGGGCTGTCTGATAAGAACTGGATCTCGAGATCCAGTTCTTATCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-484s1c1
Sequence:CCGGCCAAAGGTCAATGTCTGCATTCTCGAGAATGCAGACATTGACCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-359s1c1
Sequence:CCGGCAGGAGACACACTATCTAGCTCTCGAGAGCTAGATAGTGTGTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379979.1-210s1c1
Sequence:CCGGCTTTCAAGAGATTCGCTCCTACTCGAGTAGGAGCGAATCTCTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379979
CNPY1 MISSION shRNA Lentiviral Transduction Particles
canopy FGF signaling regulator 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-214s1c1
Sequence:CCGGCAAGAGATTCGCTCCTAGGAACTCGAGTTCCTAGGAGCGAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-198s1c1
Sequence:CCGGCGAAGGAGAGAACTTTCAAGACTCGAGTCTTGAAAGTTCTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-196s1c1
Sequence:CCGGGACGAAGGAGAGAACTTTCAACTCGAGTTGAAAGTTCTCTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-293s1c1
Sequence:CCGGCCTTTGAAATTTGCGTGTGAACTCGAGTTCACACGCAAATTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379979.1-485s1c1
Sequence:CCGGCAAAGGTCAATGTCTGCATTTCTCGAGAAATGCAGACATTGACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379979.1-281s1c1
Sequence:CCGGGATGCTTACAGACCTTTGAAACTCGAGTTTCAAAGGTCTGTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-1666s1c1
Sequence:CCGGCCCACCTAAACTCTGATTAAACTCGAGTTTAATCAGAGTTTAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-820s1c1
Sequence:CCGGGCTGTCTGATAAGAACTGGATCTCGAGATCCAGTTCTTATCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379979.1-484s1c1
Sequence:CCGGCCAAAGGTCAATGTCTGCATTCTCGAGAATGCAGACATTGACCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379979.1-359s1c1
Sequence:CCGGCAGGAGACACACTATCTAGCTCTCGAGAGCTAGATAGTGTGTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379979.1-210s1c1
Sequence:CCGGCTTTCAAGAGATTCGCTCCTACTCGAGTAGGAGCGAATCTCTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks