EMAIL THIS PAGE TO A FRIEND

CNPY2

canopy FGF signaling regulator 2

50 Gene Product Result for
Synonyms: HP10390 MSAP TMEM4 ZSIG9
UniProtKB ID: Q9Y2B0, B2R7B9, Q9UHE9
Gene ID:
Mouse(56530) canopy 2 homolog (zebrafish)
Rat(685814) canopy FGF signaling regulator 2
sheep(101108903) canopy 2 homolog (zebrafish)
domestic guinea pig(100733442) canopy 2 homolog (zebrafish)
naked mole-rat(101709336) canopy 2 homolog (zebrafish)
cow(506534) canopy 2 homolog (zebrafish)
chicken(100858933) canopy 2 homolog (zebrafish)
dog(607115) canopy 2 homolog (zebrafish)
domestic cat(101098309) canopy 2 homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008791 MISSION® esiRNA esiRNA targeting human CNPY2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014255 Rosetta Predictions human pricing
NM_001077585 Rosetta Predictions rat pricing
NM_019953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205381 predicted 632
2 SASI_Hs01_00205382 predicted 684
3 SASI_Hs01_00205383 predicted 929
4 SASI_Hs01_00205384 predicted 910
5 SASI_Hs01_00205385 predicted 687
6 SASI_Hs01_00205386 predicted 966
7 SASI_Hs01_00205387 predicted 848
8 SASI_Hs01_00205388 predicted 724
9 SASI_Hs01_00205389 predicted 695
10 SASI_Hs01_00205390 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207582 predicted 679
2 SASI_Rn02_00207583 predicted 679
3 SASI_Rn02_00207584 predicted 471
4 SASI_Rn02_00207585 predicted 747
5 SASI_Rn02_00207586 predicted 611
6 SASI_Rn02_00207587 predicted 707
7 SASI_Rn02_00207588 predicted 689
8 SASI_Rn02_00207589 predicted 504
9 SASI_Rn02_00207590 predicted 356
10 SASI_Rn02_00207591 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166381 predicted 491
2 SASI_Mm01_00166382 predicted 629
3 SASI_Mm01_00166383 predicted 711
4 SASI_Mm01_00166384 predicted 729
5 SASI_Mm01_00166385 predicted 767
6 SASI_Mm01_00166386 predicted 776
7 SASI_Mm01_00166387 predicted 696
8 SASI_Mm01_00166388 predicted 670
9 SASI_Mm01_00166389 predicted 537
10 SASI_Mm01_00166390 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014255
VALIDATED
CNPY2 MISSION shRNA Bacterial Glycerol Stock
canopy FGF signaling regulator 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-794s1c1
Sequence:CCGGGATATGTGACCGGATGAAGGACTCGAGTCCTTCATCCGGTCACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-1029s1c1
Sequence:CCGGCTTTGCAGTAAGCGAACAGATCTCGAGATCTGTTCGCTTACTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-1041s1c1
Sequence:CCGGCGAACAGATCTTTGTGACCATCTCGAGATGGTCACAAAGATCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-1040s1c1
Sequence:CCGGGCGAACAGATCTTTGTGACCACTCGAGTGGTCACAAAGATCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-846s1c1
Sequence:CCGGCGCAAGAACTACGTACGTGTACTCGAGTACACGTACGTAGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-882s1c1
Sequence:CCGGGAATCCAGTGAACTGGACCTACTCGAGTAGGTCCAGTTCACTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-825s1c1
Sequence:CCGGCAGATTGATCCTTCCACCCATCTCGAGATGGGTGGAAGGATCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-907s1c1
Sequence:CCGGGCATCCGAATCGACTCAGATACTCGAGTATCTGAGTCGATTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-698s1c1
Sequence:CCGGGATGGGATCTTTCCGGATCAACTCGAGTTGATCCGGAAAGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-941s1c1
Sequence:CCGGCAAGTTTGCGTGTGAGAGCATCTCGAGATGCTCTCACACGCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014255
VALIDATED
CNPY2 MISSION shRNA shRNA Plasmid DNA
canopy FGF signaling regulator 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-794s1c1
Sequence:CCGGGATATGTGACCGGATGAAGGACTCGAGTCCTTCATCCGGTCACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-1029s1c1
Sequence:CCGGCTTTGCAGTAAGCGAACAGATCTCGAGATCTGTTCGCTTACTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-1041s1c1
Sequence:CCGGCGAACAGATCTTTGTGACCATCTCGAGATGGTCACAAAGATCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-1040s1c1
Sequence:CCGGGCGAACAGATCTTTGTGACCACTCGAGTGGTCACAAAGATCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-846s1c1
Sequence:CCGGCGCAAGAACTACGTACGTGTACTCGAGTACACGTACGTAGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-882s1c1
Sequence:CCGGGAATCCAGTGAACTGGACCTACTCGAGTAGGTCCAGTTCACTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-825s1c1
Sequence:CCGGCAGATTGATCCTTCCACCCATCTCGAGATGGGTGGAAGGATCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-907s1c1
Sequence:CCGGGCATCCGAATCGACTCAGATACTCGAGTATCTGAGTCGATTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-698s1c1
Sequence:CCGGGATGGGATCTTTCCGGATCAACTCGAGTTGATCCGGAAAGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-941s1c1
Sequence:CCGGCAAGTTTGCGTGTGAGAGCATCTCGAGATGCTCTCACACGCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014255
VALIDATED
CNPY2 MISSION shRNA Lentiviral Transduction Particles
canopy FGF signaling regulator 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-794s1c1
Sequence:CCGGGATATGTGACCGGATGAAGGACTCGAGTCCTTCATCCGGTCACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-1029s1c1
Sequence:CCGGCTTTGCAGTAAGCGAACAGATCTCGAGATCTGTTCGCTTACTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-1041s1c1
Sequence:CCGGCGAACAGATCTTTGTGACCATCTCGAGATGGTCACAAAGATCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-1040s1c1
Sequence:CCGGGCGAACAGATCTTTGTGACCACTCGAGTGGTCACAAAGATCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-846s1c1
Sequence:CCGGCGCAAGAACTACGTACGTGTACTCGAGTACACGTACGTAGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-882s1c1
Sequence:CCGGGAATCCAGTGAACTGGACCTACTCGAGTAGGTCCAGTTCACTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-825s1c1
Sequence:CCGGCAGATTGATCCTTCCACCCATCTCGAGATGGGTGGAAGGATCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-907s1c1
Sequence:CCGGGCATCCGAATCGACTCAGATACTCGAGTATCTGAGTCGATTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014255.3-698s1c1
Sequence:CCGGGATGGGATCTTTCCGGATCAACTCGAGTTGATCCGGAAAGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014255.3-941s1c1
Sequence:CCGGCAAGTTTGCGTGTGAGAGCATCTCGAGATGCTCTCACACGCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019953
VALIDATED
CNPY2 MISSION shRNA Bacterial Glycerol Stock
canopy FGF signaling regulator 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-766s1c1
Sequence:CCGGGAAGAATACGAGGATGAGCTTCTCGAGAAGCTCATCCTCGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-811s1c1
Sequence:CCGGGACAACGTTAAAGACAAACTTCTCGAGAAGTTTGTCTTTAACGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-498s1c1
Sequence:CCGGGATGGGATCCTTCCGAATCAACTCGAGTTGATTCGGAAGGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-436s21c1
Sequence:CCGGAGGGCTCTGGTGGATGAATTACTCGAGTAATTCATCCACCAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-698s21c1
Sequence:CCGGACTTACAGGGCATCCGAATTGCTCGAGCAATTCGGATGCCCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-803s21c1
Sequence:CCGGGAGAGGCTGACAACGTTAAAGCTCGAGCTTTAACGTTGTCAGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-769s21c1
Sequence:CCGGGAATACGAGGATGAGCTTATCCTCGAGGATAAGCTCATCCTCGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-500s21c1
Sequence:CCGGTGGGATCCTTCCGAATCAATCCTCGAGGATTGATTCGGAAGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019953
VALIDATED
CNPY2 MISSION shRNA shRNA Plasmid DNA
canopy FGF signaling regulator 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-766s1c1
Sequence:CCGGGAAGAATACGAGGATGAGCTTCTCGAGAAGCTCATCCTCGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-811s1c1
Sequence:CCGGGACAACGTTAAAGACAAACTTCTCGAGAAGTTTGTCTTTAACGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-498s1c1
Sequence:CCGGGATGGGATCCTTCCGAATCAACTCGAGTTGATTCGGAAGGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-436s21c1
Sequence:CCGGAGGGCTCTGGTGGATGAATTACTCGAGTAATTCATCCACCAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-698s21c1
Sequence:CCGGACTTACAGGGCATCCGAATTGCTCGAGCAATTCGGATGCCCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-803s21c1
Sequence:CCGGGAGAGGCTGACAACGTTAAAGCTCGAGCTTTAACGTTGTCAGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-769s21c1
Sequence:CCGGGAATACGAGGATGAGCTTATCCTCGAGGATAAGCTCATCCTCGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-500s21c1
Sequence:CCGGTGGGATCCTTCCGAATCAATCCTCGAGGATTGATTCGGAAGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019953
VALIDATED
CNPY2 MISSION shRNA Lentiviral Transduction Particles
canopy FGF signaling regulator 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-766s1c1
Sequence:CCGGGAAGAATACGAGGATGAGCTTCTCGAGAAGCTCATCCTCGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-811s1c1
Sequence:CCGGGACAACGTTAAAGACAAACTTCTCGAGAAGTTTGTCTTTAACGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019953.1-498s1c1
Sequence:CCGGGATGGGATCCTTCCGAATCAACTCGAGTTGATTCGGAAGGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-436s21c1
Sequence:CCGGAGGGCTCTGGTGGATGAATTACTCGAGTAATTCATCCACCAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-698s21c1
Sequence:CCGGACTTACAGGGCATCCGAATTGCTCGAGCAATTCGGATGCCCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-803s21c1
Sequence:CCGGGAGAGGCTGACAACGTTAAAGCTCGAGCTTTAACGTTGTCAGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-769s21c1
Sequence:CCGGGAATACGAGGATGAGCTTATCCTCGAGGATAAGCTCATCCTCGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019953.1-500s21c1
Sequence:CCGGTGGGATCCTTCCGAATCAATCCTCGAGGATTGATTCGGAAGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks