EMAIL THIS PAGE TO A FRIEND

CNPY3

canopy FGF signaling regulator 3

56 Gene Product Result for
Synonyms: CAG4A ERDA5 PRAT4A TNRC5
UniProtKB ID: Q9BT09, O15412, Q0P6I2, Q8NF54, Q8WTU8, Q9P0F2
Gene ID:
Human(10695) Summary: PRAT4A is associated with the immature form of TLR4 (MIM 603030) and regulates its cell surface expression (Wakabayashi et al., 2006 [PubMed 16849487]
Mouse(72029) canopy 3 homolog (zebrafish)
Rat(685174) canopy FGF signaling regulator 3
dog(609385) canopy 3 homolog (zebrafish)
cow(510220) canopy 3 homolog (zebrafish)
domestic cat(101082750) canopy 3 homolog (zebrafish)
naked mole-rat(101696850) canopy 3 homolog (zebrafish)
domestic guinea pig(100735948) canopy 3 homolog (zebrafish)
sheep(101110884) canopy 3 homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006586 Rosetta Predictions human pricing
NM_183010 Rosetta Predictions human pricing
NM_001134710 Rosetta Predictions rat pricing
NM_028065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341885 predicted 756
2 SASI_Hs02_00341886 predicted 832
3 SASI_Hs01_00031600 predicted 1442
4 SASI_Hs01_00031601 predicted 1537
5 SASI_Hs02_00341887 predicted 826
6 SASI_Hs01_00031602 predicted 1015
7 SASI_Hs01_00031604 predicted 1002
8 SASI_Hs01_00031605 predicted 1515
9 SASI_Hs01_00031606 predicted 1066
10 SASI_Hs01_00031607 predicted 1032
11 SASI_Hs01_00031598 predicted 889
12 SASI_Hs01_00031599 predicted 891
13 SASI_Hs01_00031603 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203511 predicted 750
2 SASI_Hs01_00203512 predicted 749
3 SASI_Hs01_00203513 predicted 826
4 SASI_Hs01_00203514 predicted 813
5 SASI_Hs01_00203515 predicted 881
6 SASI_Hs01_00203516 predicted 843
7 SASI_Hs01_00203517 predicted 807
8 SASI_Hs01_00203518 predicted 571
9 SASI_Hs01_00203519 predicted 528
10 SASI_Hs01_00203520 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258094 predicted 578
2 SASI_Rn02_00258095 predicted 287
3 SASI_Rn02_00258096 predicted 832
4 SASI_Rn02_00258097 predicted 1257
5 SASI_Rn02_00258098 predicted 487
6 SASI_Rn02_00258099 predicted 386
7 SASI_Rn02_00258100 predicted 924
8 SASI_Rn02_00258101 predicted 306
9 SASI_Rn02_00258102 predicted 1101
10 SASI_Rn02_00258103 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186475 predicted 357
2 SASI_Mm01_00186476 predicted 996
3 SASI_Mm01_00186477 predicted 916
4 SASI_Mm01_00186478 predicted 922
5 SASI_Mm01_00186479 predicted 655
6 SASI_Mm01_00186480 predicted 458
7 SASI_Mm01_00186481 predicted 232
8 SASI_Mm01_00186482 predicted 640
9 SASI_Mm01_00186483 predicted 378
10 SASI_Mm01_00186484 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006586
VALIDATED
CNPY3 MISSION shRNA Bacterial Glycerol Stock
canopy FGF signaling regulator 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-897s21c1
Sequence:CCGGGAGCTGTGGAACGAGACTTCTCTCGAGAGAAGTCTCGTTCCACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006586.3-1410s21c1
Sequence:CCGGTCTGCCAAGGAAAGACACAAGCTCGAGCTTGTGTCTTTCCTTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-626s21c1
Sequence:CCGGGAAGTCAGCCTTTGAGGAAACCTCGAGGTTTCCTCAAAGGCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-795s21c1
Sequence:CCGGAGGACCGGCAGCAATCGATTTCTCGAGAAATCGATTGCTGCCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-694s21c1
Sequence:CCGGAGAAGGCCTCTGGAGTCAAATCTCGAGATTTGACTCCAGAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006586.3-1542s21c1
Sequence:CCGGAGGACTCCAGTGTGAACTCAGCTCGAGCTGAGTTCACACTGGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-778s1c1
Sequence:CCGGGAGACATTACACAACCTGGTACTCGAGTACCAGGTTGTGTAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006586.2-708s1c1
Sequence:CCGGCCTGGATTATAGCCTGCACAACTCGAGTTGTGCAGGCTATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-765s1c1
Sequence:CCGGGTCAGAGACCTTTGAGACATTCTCGAGAATGTCTCAAAGGTCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-771s1c1
Sequence:CCGGGACCTTTGAGACATTACACAACTCGAGTTGTGTAATGTCTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006586.2-782s1c1
Sequence:CCGGCATTACACAACCTGGTACACACTCGAGTGTGTACCAGGTTGTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006586
VALIDATED
CNPY3 MISSION shRNA shRNA Plasmid DNA
canopy FGF signaling regulator 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-897s21c1
Sequence:CCGGGAGCTGTGGAACGAGACTTCTCTCGAGAGAAGTCTCGTTCCACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006586.3-1410s21c1
Sequence:CCGGTCTGCCAAGGAAAGACACAAGCTCGAGCTTGTGTCTTTCCTTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-626s21c1
Sequence:CCGGGAAGTCAGCCTTTGAGGAAACCTCGAGGTTTCCTCAAAGGCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-795s21c1
Sequence:CCGGAGGACCGGCAGCAATCGATTTCTCGAGAAATCGATTGCTGCCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-694s21c1
Sequence:CCGGAGAAGGCCTCTGGAGTCAAATCTCGAGATTTGACTCCAGAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006586.3-1542s21c1
Sequence:CCGGAGGACTCCAGTGTGAACTCAGCTCGAGCTGAGTTCACACTGGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-778s1c1
Sequence:CCGGGAGACATTACACAACCTGGTACTCGAGTACCAGGTTGTGTAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006586.2-708s1c1
Sequence:CCGGCCTGGATTATAGCCTGCACAACTCGAGTTGTGCAGGCTATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-765s1c1
Sequence:CCGGGTCAGAGACCTTTGAGACATTCTCGAGAATGTCTCAAAGGTCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-771s1c1
Sequence:CCGGGACCTTTGAGACATTACACAACTCGAGTTGTGTAATGTCTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006586.2-782s1c1
Sequence:CCGGCATTACACAACCTGGTACACACTCGAGTGTGTACCAGGTTGTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006586
VALIDATED
CNPY3 MISSION shRNA Lentiviral Transduction Particles
canopy FGF signaling regulator 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-897s21c1
Sequence:CCGGGAGCTGTGGAACGAGACTTCTCTCGAGAGAAGTCTCGTTCCACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006586.3-1410s21c1
Sequence:CCGGTCTGCCAAGGAAAGACACAAGCTCGAGCTTGTGTCTTTCCTTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-626s21c1
Sequence:CCGGGAAGTCAGCCTTTGAGGAAACCTCGAGGTTTCCTCAAAGGCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-795s21c1
Sequence:CCGGAGGACCGGCAGCAATCGATTTCTCGAGAAATCGATTGCTGCCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006586.3-694s21c1
Sequence:CCGGAGAAGGCCTCTGGAGTCAAATCTCGAGATTTGACTCCAGAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006586.3-1542s21c1
Sequence:CCGGAGGACTCCAGTGTGAACTCAGCTCGAGCTGAGTTCACACTGGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-778s1c1
Sequence:CCGGGAGACATTACACAACCTGGTACTCGAGTACCAGGTTGTGTAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006586.2-708s1c1
Sequence:CCGGCCTGGATTATAGCCTGCACAACTCGAGTTGTGCAGGCTATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-765s1c1
Sequence:CCGGGTCAGAGACCTTTGAGACATTCTCGAGAATGTCTCAAAGGTCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006586.2-771s1c1
Sequence:CCGGGACCTTTGAGACATTACACAACTCGAGTTGTGTAATGTCTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006586.2-782s1c1
Sequence:CCGGCATTACACAACCTGGTACACACTCGAGTGTGTACCAGGTTGTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028065
VALIDATED
CNPY3 MISSION shRNA Bacterial Glycerol Stock
canopy FGF signaling regulator 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-300s21c1
Sequence:CCGGGAAGTGATTGACACCGGCTATCTCGAGATAGCCGGTGTCAATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-600s21c1
Sequence:CCGGGAAGAGTTTGAAGAGGTGATTCTCGAGAATCACCTCTTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028065.3-1052s21c1
Sequence:CCGGCCTTCCCTTGAACAACAGCAACTCGAGTTGCTGTTGTTCAAGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-350s21c1
Sequence:CCGGCAAGTACACCAAGTCGGACTTCTCGAGAAGTCCGACTTGGTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-349s1c1
Sequence:CCGGCAAGTACACCAAGTCGGACTTCTCGAGAAGTCCGACTTGGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028065.2-599s1c1
Sequence:CCGGGAAGAGTTTGAAGAGGTGATTCTCGAGAATCACCTCTTCAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-299s1c1
Sequence:CCGGGAAGTGATTGACACCGGCTATCTCGAGATAGCCGGTGTCAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-1050s1c1
Sequence:CCGGCCTTCCCTTGAACAACAGCAACTCGAGTTGCTGTTGTTCAAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028065
VALIDATED
CNPY3 MISSION shRNA shRNA Plasmid DNA
canopy FGF signaling regulator 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-300s21c1
Sequence:CCGGGAAGTGATTGACACCGGCTATCTCGAGATAGCCGGTGTCAATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-600s21c1
Sequence:CCGGGAAGAGTTTGAAGAGGTGATTCTCGAGAATCACCTCTTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028065.3-1052s21c1
Sequence:CCGGCCTTCCCTTGAACAACAGCAACTCGAGTTGCTGTTGTTCAAGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-350s21c1
Sequence:CCGGCAAGTACACCAAGTCGGACTTCTCGAGAAGTCCGACTTGGTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-349s1c1
Sequence:CCGGCAAGTACACCAAGTCGGACTTCTCGAGAAGTCCGACTTGGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028065.2-599s1c1
Sequence:CCGGGAAGAGTTTGAAGAGGTGATTCTCGAGAATCACCTCTTCAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-299s1c1
Sequence:CCGGGAAGTGATTGACACCGGCTATCTCGAGATAGCCGGTGTCAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-1050s1c1
Sequence:CCGGCCTTCCCTTGAACAACAGCAACTCGAGTTGCTGTTGTTCAAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028065
VALIDATED
CNPY3 MISSION shRNA Lentiviral Transduction Particles
canopy FGF signaling regulator 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-300s21c1
Sequence:CCGGGAAGTGATTGACACCGGCTATCTCGAGATAGCCGGTGTCAATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-600s21c1
Sequence:CCGGGAAGAGTTTGAAGAGGTGATTCTCGAGAATCACCTCTTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028065.3-1052s21c1
Sequence:CCGGCCTTCCCTTGAACAACAGCAACTCGAGTTGCTGTTGTTCAAGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028065.3-350s21c1
Sequence:CCGGCAAGTACACCAAGTCGGACTTCTCGAGAAGTCCGACTTGGTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-349s1c1
Sequence:CCGGCAAGTACACCAAGTCGGACTTCTCGAGAAGTCCGACTTGGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028065.2-599s1c1
Sequence:CCGGGAAGAGTTTGAAGAGGTGATTCTCGAGAATCACCTCTTCAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-299s1c1
Sequence:CCGGGAAGTGATTGACACCGGCTATCTCGAGATAGCCGGTGTCAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028065.2-1050s1c1
Sequence:CCGGCCTTCCCTTGAACAACAGCAACTCGAGTTGCTGTTGTTCAAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks