EMAIL THIS PAGE TO A FRIEND

CNPY4

canopy FGF signaling regulator 4

103 Gene Product Result for
Synonyms: PRAT4B
UniProtKB ID: Q8N129, Q8WUN9
Gene ID:
Mouse(66455) canopy 4 homolog (zebrafish)
Rat(363886) canopy FGF signaling regulator 4
sheep(101107493) canopy 4 homolog (zebrafish)
domestic guinea pig(100719041) canopy 4 homolog (zebrafish)
naked mole-rat(101696568) canopy 4 homolog (zebrafish)
cow(505637) canopy 4 homolog (zebrafish)
domestic cat(101089162) canopy 4 homolog (zebrafish)
dog(489845) canopy 4 homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152755 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152755 Rosetta Predictions human pricing
NM_001108852 Rosetta Predictions rat pricing
NM_178612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119146 predicted 1091
2 SASI_Hs01_00119147 predicted 311
3 SASI_Hs01_00119148 predicted 466
4 SASI_Hs01_00119149 predicted 393
5 SASI_Hs01_00119150 predicted 248
6 SASI_Hs01_00119151 predicted 239
7 SASI_Hs01_00119152 predicted 1052
8 SASI_Hs01_00119154 predicted 445
9 SASI_Hs02_00366681 predicted 361
10 SASI_Hs02_00366682 predicted 1100
11 SASI_Hs01_00119153 predicted 1169
12 SASI_Hs01_00119155 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242715 predicted 1007
2 SASI_Rn02_00242716 predicted 934
3 SASI_Rn02_00242717 predicted 1120
4 SASI_Rn02_00242718 predicted 946
5 SASI_Rn02_00242719 predicted 312
6 SASI_Rn02_00242720 predicted 1002
7 SASI_Rn02_00242721 predicted 973
8 SASI_Rn02_00242722 predicted 396
9 SASI_Rn02_00242723 predicted 965
10 SASI_Rn02_00242724 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200811 predicted 986
2 SASI_Mm02_00348961 predicted 772
3 SASI_Mm01_00200812 predicted 358
4 SASI_Mm01_00200813 predicted 428
5 SASI_Mm01_00200814 predicted 1046
6 SASI_Mm01_00200815 predicted 877
7 SASI_Mm01_00200816 predicted 634
8 SASI_Mm01_00200817 predicted 416
9 SASI_Mm01_00200818 predicted 867
10 SASI_Mm02_00348962 predicted 1002
11 SASI_Mm01_00200810 predicted 663
12 SASI_Mm01_00200819 predicted 1184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152755
CNPY4 MISSION shRNA Bacterial Glycerol Stock
canopy FGF signaling regulator 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152755.1-598s1c1
Sequence:CCGGCATTGTGGGAGACTGGTACTTCTCGAGAAGTACCAGTCTCCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-336s1c1
Sequence:CCGGCTTACAGCGTTTCAGAGACAACTCGAGTTGTCTCTGAAACGCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152755.1-559s1c1
Sequence:CCGGCAAGAAGCAGTGTGAGACCATCTCGAGATGGTCTCACACTGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152755.1-1245s1c1
Sequence:CCGGCGGACATTCTCTGCGATCTATCTCGAGATAGATCGCAGAGAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-362s1c1
Sequence:CCGGGAAGAGGCCTTAGAGAATTTACTCGAGTAAATTCTCTAAGGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-207s1c1
Sequence:CCGGCCAGCAAATGCGAAGTGTGTACTCGAGTACACACTTCGCATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152755.1-1055s1c1
Sequence:CCGGGCTCCTAGAGATGAACTCTATCTCGAGATAGAGTTCATCTCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152755.1-829s21c1
Sequence:CCGGACTTGACCGAGAAGATCTTTGCTCGAGCAAAGATCTTCTCGGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152755
CNPY4 MISSION shRNA shRNA Plasmid DNA
canopy FGF signaling regulator 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152755.1-598s1c1
Sequence:CCGGCATTGTGGGAGACTGGTACTTCTCGAGAAGTACCAGTCTCCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-336s1c1
Sequence:CCGGCTTACAGCGTTTCAGAGACAACTCGAGTTGTCTCTGAAACGCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152755.1-559s1c1
Sequence:CCGGCAAGAAGCAGTGTGAGACCATCTCGAGATGGTCTCACACTGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152755.1-1245s1c1
Sequence:CCGGCGGACATTCTCTGCGATCTATCTCGAGATAGATCGCAGAGAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-362s1c1
Sequence:CCGGGAAGAGGCCTTAGAGAATTTACTCGAGTAAATTCTCTAAGGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-207s1c1
Sequence:CCGGCCAGCAAATGCGAAGTGTGTACTCGAGTACACACTTCGCATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152755.1-1055s1c1
Sequence:CCGGGCTCCTAGAGATGAACTCTATCTCGAGATAGAGTTCATCTCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152755.1-829s21c1
Sequence:CCGGACTTGACCGAGAAGATCTTTGCTCGAGCAAAGATCTTCTCGGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152755
CNPY4 MISSION shRNA Lentiviral Transduction Particles
canopy FGF signaling regulator 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152755.1-598s1c1
Sequence:CCGGCATTGTGGGAGACTGGTACTTCTCGAGAAGTACCAGTCTCCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-336s1c1
Sequence:CCGGCTTACAGCGTTTCAGAGACAACTCGAGTTGTCTCTGAAACGCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152755.1-559s1c1
Sequence:CCGGCAAGAAGCAGTGTGAGACCATCTCGAGATGGTCTCACACTGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152755.1-1245s1c1
Sequence:CCGGCGGACATTCTCTGCGATCTATCTCGAGATAGATCGCAGAGAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-362s1c1
Sequence:CCGGGAAGAGGCCTTAGAGAATTTACTCGAGTAAATTCTCTAAGGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152755.1-207s1c1
Sequence:CCGGCCAGCAAATGCGAAGTGTGTACTCGAGTACACACTTCGCATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152755.1-1055s1c1
Sequence:CCGGGCTCCTAGAGATGAACTCTATCTCGAGATAGAGTTCATCTCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152755.1-829s21c1
Sequence:CCGGACTTGACCGAGAAGATCTTTGCTCGAGCAAAGATCTTCTCGGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178612
VALIDATED
CNPY4 MISSION shRNA Bacterial Glycerol Stock
canopy FGF signaling regulator 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178612.2-414s1c1
Sequence:CCGGGTCAAAGTCAGACTATGGCAACTCGAGTTGCCATAGTCTGACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178612.2-362s1c1
Sequence:CCGGCTGGATTACAATGTTCATGCTCTCGAGAGCATGAACATTGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-408s1c1
Sequence:CCGGCCAAGGGTCAAAGTCAGACTACTCGAGTAGTCTGACTTTGACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-146s1c1
Sequence:CCGGGAGGAGGAAGATGACACAGAACTCGAGTTCTGTGTCATCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-551s1c1
Sequence:CCGGGAGGAGTTTGAAGATGTTGTACTCGAGTACAACATCTTCAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-725s1c1
Sequence:CCGGGAGGAAGAAGAAGAAGAGATACTCGAGTATCTCTTCTTCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178612.4-1454s1c1
Sequence:CCGGGGTAGACATGTGGGCTATATTCTCGAGAATATAGCCCACATGTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178612
VALIDATED
CNPY4 MISSION shRNA shRNA Plasmid DNA
canopy FGF signaling regulator 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178612.2-414s1c1
Sequence:CCGGGTCAAAGTCAGACTATGGCAACTCGAGTTGCCATAGTCTGACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178612.2-362s1c1
Sequence:CCGGCTGGATTACAATGTTCATGCTCTCGAGAGCATGAACATTGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-408s1c1
Sequence:CCGGCCAAGGGTCAAAGTCAGACTACTCGAGTAGTCTGACTTTGACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-146s1c1
Sequence:CCGGGAGGAGGAAGATGACACAGAACTCGAGTTCTGTGTCATCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-551s1c1
Sequence:CCGGGAGGAGTTTGAAGATGTTGTACTCGAGTACAACATCTTCAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-725s1c1
Sequence:CCGGGAGGAAGAAGAAGAAGAGATACTCGAGTATCTCTTCTTCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178612.4-1454s1c1
Sequence:CCGGGGTAGACATGTGGGCTATATTCTCGAGAATATAGCCCACATGTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178612
VALIDATED
CNPY4 MISSION shRNA Lentiviral Transduction Particles
canopy FGF signaling regulator 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178612.2-414s1c1
Sequence:CCGGGTCAAAGTCAGACTATGGCAACTCGAGTTGCCATAGTCTGACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178612.2-362s1c1
Sequence:CCGGCTGGATTACAATGTTCATGCTCTCGAGAGCATGAACATTGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-408s1c1
Sequence:CCGGCCAAGGGTCAAAGTCAGACTACTCGAGTAGTCTGACTTTGACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-146s1c1
Sequence:CCGGGAGGAGGAAGATGACACAGAACTCGAGTTCTGTGTCATCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-551s1c1
Sequence:CCGGGAGGAGTTTGAAGATGTTGTACTCGAGTACAACATCTTCAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178612.2-725s1c1
Sequence:CCGGGAGGAAGAAGAAGAAGAGATACTCGAGTATCTCTTCTTCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178612.4-1454s1c1
Sequence:CCGGGGTAGACATGTGGGCTATATTCTCGAGAATATAGCCCACATGTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks