EMAIL THIS PAGE TO A FRIEND

CNR1

cannabinoid receptor 1 (brain)

115 Gene Product Result for
Synonyms: CANN6 CB-R CB1 CB1A CB1K5 CB1R CNR
Gene ID:
Human(1268) Summary: This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]
Mouse(12801) cannabinoid receptor 1 (brain)
Rat(25248) cannabinoid receptor 1 (brain)
Zebrafish(404209) cannabinoid receptor 1
domestic cat(493926) cannabinoid receptor 1 (brain)
cow(100299449) cannabinoid receptor 1 (brain)
Horse(100065681) cannabinoid receptor 1 (brain)
dog(481913) cannabinoid receptor 1 (brain)
chicken(428633) cannabinoid receptor 1 (brain)
naked mole-rat(101697935) cannabinoid receptor 1 (brain)
domestic guinea pig(100169690) cannabinoid receptor 1 (brain)
sheep(101111639) cannabinoid receptor 1 (brain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500190 Anti-Cannabinoid receptor 1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat
ELISA, western blot pricing
C1108 Anti-Cannabinoid Receptor 1 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunocytochemistry, western blot pricing
C2866 Anti-Cannabinoid Receptor 1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunocytochemistry, immunohistochemistry pricing
C1233 Anti-Cannabinoid Receptor 1 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, monkey, human, rat, chicken, goldfish (and salamander)
immunocytochemistry, western blot pricing
SAB1305934 ANTI-CB1 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2502004 Anti-CNR1 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat, canine, bovine
ELISA, western blot pricing
SAB2502003 Anti-CNR1 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, bovine, mouse, rat, canine, human
ELISA, western blot pricing
SAB1405638 Anti-CNR1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4500345 Anti-CNR1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA042256 Anti-CNR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0001268M1 Monoclonal Anti-CNR1 antibody produced in mouse clone 2F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403683 Monoclonal Anti-CNR1, (N-terminal) antibody produced in mouse clone 1F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
T2376 L-Thyroxine ≥98% (HPLC) human, mouse, rat pricing
T1775 L-Thyroxine powder, BioReagent, suitable for cell culture human, mouse, rat pricing
H1911 N-(4-Hydroxyphenyl)-arachidonylamide ≥98%, ethanol solution human, mouse, rat pricing
O0383 N-Oleoylethanolamine ~98% (TLC) human, mouse, rat pricing
A8973 2-Arachidonyl glycerol ~10 mg/mL, ≥98% (HPLC) human, rat pricing
D214256 5,5-Diphenyl-2-thiohydantoin 99% human, rat pricing
D4007 5,5-Diphenylhydantoin ≥99% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
C6395 Cannabidiol solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, rat pricing
C6888 Cannabinol analytical standard human, rat pricing
H7909 HU-210 solid (air sensitive) human, rat pricing
W515604 Isopropyl palmitate ≥90% human, rat pricing
291781 Isopropyl palmitate technical grade, 90% human, rat pricing
J4252 JWH-015 ≥98% (HPLC), powder human, rat pricing
P5177 Methyl palmitate ≥99% (capillary GC) human, rat pricing
76159 Methyl palmitate analytical standard human, rat pricing
W509531 Methyl palmitate ≥97% human, rat pricing
P0359 Palmitoylethanolamide human, rat pricing
P0627 PTH-glycine human, rat pricing
A6226 AM251 >98% (HPLC), solid mouse, rat pricing
T0397 L-Thyroxine sodium salt pentahydrate γ-irradiated, powder, BioXtra, suitable for cell culture mouse, rat pricing
T2501 L-Thyroxine sodium salt pentahydrate ≥98% (HPLC), powder mouse, rat pricing
M186 R(+)-Methanandamide 5 mg/mL in absolute ethanol, ≥96% (HPLC) mouse, rat pricing
H2510 1-O-Palmityl-rac-glycerol ~99% rat pricing
52302 1-O-Palmityl-rac-glycerol ≥99.0% (GC) rat pricing
A0980 AM281 ≥98% (HPLC) rat pricing
S8439 Stearoyl ethanolamide ≥98%, crystalline rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001840 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016083 Rosetta Predictions human pricing
NM_033181 Rosetta Predictions human pricing
NM_012784 Rosetta Predictions rat pricing
NM_007726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106167 predicted 1750
2 SASI_Hs01_00106168 predicted 1242
3 SASI_Hs01_00106170 predicted 828
4 SASI_Hs01_00106171 predicted 1072
5 SASI_Hs01_00106172 predicted 576
6 SASI_Hs01_00106173 predicted 775
7 SASI_Hs01_00106174 predicted 1947
8 SASI_Hs01_00106175 predicted 1929
9 SASI_Hs01_00106176 predicted 1201
10 SASI_Hs02_00348834 predicted 864
11 SASI_Hs01_00106169 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243632 predicted 1584
2 SASI_Hs01_00243633 predicted 1071
3 SASI_Hs01_00243635 predicted 665
4 SASI_Hs01_00243636 predicted 898
5 SASI_Hs01_00243637 predicted 409
6 SASI_Hs01_00243638 predicted 610
7 SASI_Hs01_00243639 predicted 1773
8 SASI_Hs01_00243640 predicted 1757
9 SASI_Hs01_00243641 predicted 1042
10 SASI_Hs02_00360963 predicted 695
11 SASI_Hs01_00243634 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260189 predicted 378
2 SASI_Rn01_00080902 predicted 862
3 SASI_Rn01_00080903 predicted 373
4 SASI_Rn01_00080904 predicted 1276
5 SASI_Rn01_00080905 predicted 219
6 SASI_Rn01_00080906 predicted 281
7 SASI_Rn01_00080908 predicted 1013
8 SASI_Rn02_00260190 predicted 1256
9 SASI_Rn01_00080910 predicted 411
10 SASI_Rn01_00080911 predicted 233
11 SASI_Rn01_00080907 predicted 718
12 SASI_Rn01_00080909 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052163 predicted 1359
2 SASI_Mm01_00052164 predicted 1713
3 SASI_Mm01_00052165 predicted 1088
4 SASI_Mm02_00312317 predicted 841
5 SASI_Mm01_00052166 predicted 658
6 SASI_Mm01_00052167 predicted 718
7 SASI_Mm01_00052168 predicted 1376
8 SASI_Mm01_00052170 predicted 589
9 SASI_Mm01_00052171 predicted 1106
10 SASI_Mm01_00052172 predicted 707
11 SASI_Mm01_00052169 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033181
CNR1 MISSION shRNA Bacterial Glycerol Stock
cannabinoid receptor 1 (brain)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000356911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033181.3-1529s21c1
Sequence:CCGGTGCTAATGTTTCCATAGTTTACTCGAGTAAACTATGGAAACATTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033181.3-1755s21c1
Sequence:CCGGTAGTATCAGAGATGTCCATTTCTCGAGAAATGGACATCTCTGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033181.3-1082s21c1
Sequence:CCGGAGCTCATTAAGACGGTGTTTGCTCGAGCAAACACCGTCTTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033181.3-821s21c1
Sequence:CCGGTGCTTCTGTTCATCGTGTATGCTCGAGCATACACGATGAACAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033181
CNR1 MISSION shRNA shRNA Plasmid DNA
cannabinoid receptor 1 (brain)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000356911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033181.3-1529s21c1
Sequence:CCGGTGCTAATGTTTCCATAGTTTACTCGAGTAAACTATGGAAACATTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033181.3-1755s21c1
Sequence:CCGGTAGTATCAGAGATGTCCATTTCTCGAGAAATGGACATCTCTGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033181.3-1082s21c1
Sequence:CCGGAGCTCATTAAGACGGTGTTTGCTCGAGCAAACACCGTCTTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033181.3-821s21c1
Sequence:CCGGTGCTTCTGTTCATCGTGTATGCTCGAGCATACACGATGAACAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033181
CNR1 MISSION shRNA Lentiviral Transduction Particles
cannabinoid receptor 1 (brain)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000356911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033181.3-1529s21c1
Sequence:CCGGTGCTAATGTTTCCATAGTTTACTCGAGTAAACTATGGAAACATTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033181.3-1755s21c1
Sequence:CCGGTAGTATCAGAGATGTCCATTTCTCGAGAAATGGACATCTCTGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033181.3-1082s21c1
Sequence:CCGGAGCTCATTAAGACGGTGTTTGCTCGAGCAAACACCGTCTTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033181.3-821s21c1
Sequence:CCGGTGCTTCTGTTCATCGTGTATGCTCGAGCATACACGATGAACAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007726
CNR1 MISSION shRNA Bacterial Glycerol Stock
cannabinoid receptor 1 (brain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-796s1c1
Sequence:CCGGTCAGACATCTTCCCACTCATTCTCGAGAATGAGTGGGAAGATGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-230s1c1
Sequence:CCGGCCAACATTACAGAGTTCTATACTCGAGTATAGAACTCTGTAATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-1119s1c1
Sequence:CCGGCAAGCTTATCAAGACGGTGTTCTCGAGAACACCGTCTTGATAAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-732s1c1
Sequence:CCGGTGCAATAGTAATTGCTGTGTTCTCGAGAACACAGCAATTACTATTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-544s1c1
Sequence:CCGGCACCGCAAAGATAGTCCCAATCTCGAGATTGGGACTATCTTTGCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007726
CNR1 MISSION shRNA shRNA Plasmid DNA
cannabinoid receptor 1 (brain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-796s1c1
Sequence:CCGGTCAGACATCTTCCCACTCATTCTCGAGAATGAGTGGGAAGATGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-230s1c1
Sequence:CCGGCCAACATTACAGAGTTCTATACTCGAGTATAGAACTCTGTAATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-1119s1c1
Sequence:CCGGCAAGCTTATCAAGACGGTGTTCTCGAGAACACCGTCTTGATAAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-732s1c1
Sequence:CCGGTGCAATAGTAATTGCTGTGTTCTCGAGAACACAGCAATTACTATTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-544s1c1
Sequence:CCGGCACCGCAAAGATAGTCCCAATCTCGAGATTGGGACTATCTTTGCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007726
CNR1 MISSION shRNA Lentiviral Transduction Particles
cannabinoid receptor 1 (brain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-796s1c1
Sequence:CCGGTCAGACATCTTCCCACTCATTCTCGAGAATGAGTGGGAAGATGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-230s1c1
Sequence:CCGGCCAACATTACAGAGTTCTATACTCGAGTATAGAACTCTGTAATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-1119s1c1
Sequence:CCGGCAAGCTTATCAAGACGGTGTTCTCGAGAACACCGTCTTGATAAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-732s1c1
Sequence:CCGGTGCAATAGTAATTGCTGTGTTCTCGAGAACACAGCAATTACTATTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007726.1-544s1c1
Sequence:CCGGCACCGCAAAGATAGTCCCAATCTCGAGATTGGGACTATCTTTGCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001840
CNR1 MISSION shRNA Bacterial Glycerol Stock
cannabinoid receptor 1 (brain)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-1441s1c1
Sequence:CCGGCCTGCACAAACACGCAAACAACTCGAGTTGTTTGCGTGTTTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-928s1c1
Sequence:CCGGGCAATCTGTTTGCTCAGACATCTCGAGATGTCTGAGCAAACAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-370s1c1
Sequence:CCGGCCAGGTGAACATTACAGAATTCTCGAGAATTCTGTAATGTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-704s1c1
Sequence:CCGGCGCAACGTGTTTCTGTTCAAACTCGAGTTTGAACAGAAACACGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001840.1-1575s1c1
Sequence:CCGGGCCTCCCTGGCAGCACAGGAACTCGAGTTCCTGTGCTGCCAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001840
CNR1 MISSION shRNA shRNA Plasmid DNA
cannabinoid receptor 1 (brain)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-1441s1c1
Sequence:CCGGCCTGCACAAACACGCAAACAACTCGAGTTGTTTGCGTGTTTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-928s1c1
Sequence:CCGGGCAATCTGTTTGCTCAGACATCTCGAGATGTCTGAGCAAACAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-370s1c1
Sequence:CCGGCCAGGTGAACATTACAGAATTCTCGAGAATTCTGTAATGTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-704s1c1
Sequence:CCGGCGCAACGTGTTTCTGTTCAAACTCGAGTTTGAACAGAAACACGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001840.1-1575s1c1
Sequence:CCGGGCCTCCCTGGCAGCACAGGAACTCGAGTTCCTGTGCTGCCAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001840
CNR1 MISSION shRNA Lentiviral Transduction Particles
cannabinoid receptor 1 (brain)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-1441s1c1
Sequence:CCGGCCTGCACAAACACGCAAACAACTCGAGTTGTTTGCGTGTTTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-928s1c1
Sequence:CCGGGCAATCTGTTTGCTCAGACATCTCGAGATGTCTGAGCAAACAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-370s1c1
Sequence:CCGGCCAGGTGAACATTACAGAATTCTCGAGAATTCTGTAATGTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001840.1-704s1c1
Sequence:CCGGCGCAACGTGTTTCTGTTCAAACTCGAGTTTGAACAGAAACACGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001840.1-1575s1c1
Sequence:CCGGGCCTCCCTGGCAGCACAGGAACTCGAGTTCCTGTGCTGCCAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks