EMAIL THIS PAGE TO A FRIEND

CNR2

cannabinoid receptor 2 (macrophage)

92 Gene Product Result for
Synonyms: CB-2 CB2 CX5
UniProtKB ID: P34972, Q4VBK8, Q5JRH7, Q6B0G7, Q6NSY0
Gene ID:
Human(1269) Summary: The cannabinoid delta-9-tetrahydrocannabinol is the principal psychoactive ingredient of marijuana. The proteins encoded by this gene and the cannabinoid receptor 1 (brain) (CNR1) gene have the characteristics of a guanine nucleotide-binding protein (G-protein)-coupled receptor for cannabinoids. They inhibit adenylate cyclase activity in a dose-dependent, stereoselective, and pertussis toxin-sensitive manner. These proteins have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. The cannabinoid receptors are members of family 1 of the G-protein-coupled receptors. [provided by RefSeq, Jul 2008]
Mouse(12802) cannabinoid receptor 2 (macrophage)
Rat(57302) cannabinoid receptor 2 (macrophage)
sheep(101119188) cannabinoid receptor 2 (macrophage)
domestic guinea pig(100721528) cannabinoid receptor 2 (macrophage)
Zebrafish(795246) cannabinoid receptor 2
dog(612289) cannabinoid receptor 2 (macrophage)
cow(539769) cannabinoid receptor 2 (macrophage)
Horse(100071536) cannabinoid receptor 2 (macrophage)
domestic cat(101100234) cannabinoid receptor 2 (macrophage)
chicken(428232) cannabinoid receptor 2 (macrophage)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
W102 (R)-(+)-WIN 55,212-2 mesylate salt ≥98% (HPLC) human pricing
I151 Indomethacin morpholinylamide solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
T2386 Δ9-Tetrahydrocannabinol solution ethanol solution human, mouse, rat pricing
T4764 Δ9-Tetrahydrocannabinol solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
T2376 L-Thyroxine ≥98% (HPLC) human, mouse, rat pricing
T1775 L-Thyroxine powder, BioReagent, suitable for cell culture human, mouse, rat pricing
H1911 N-(4-Hydroxyphenyl)-arachidonylamide ≥98%, ethanol solution human, mouse, rat pricing
O0383 N-Oleoylethanolamine ~98% (TLC) human, mouse, rat pricing
A8973 2-Arachidonyl glycerol ~10 mg/mL, ≥98% (HPLC) human, rat pricing
D214256 5,5-Diphenyl-2-thiohydantoin 99% human, rat pricing
D4007 5,5-Diphenylhydantoin ≥99% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
C6395 Cannabidiol solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, rat pricing
C6888 Cannabinol analytical standard human, rat pricing
C6520 Cannabinol solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, rat pricing
H7909 HU-210 solid (air sensitive) human, rat pricing
W515604 Isopropyl palmitate ≥90% human, rat pricing
291781 Isopropyl palmitate technical grade, 90% human, rat pricing
P5177 Methyl palmitate ≥99% (capillary GC) human, rat pricing
76159 Methyl palmitate analytical standard human, rat pricing
W509531 Methyl palmitate ≥97% human, rat pricing
P0627 PTH-glycine human, rat pricing
A6226 AM251 >98% (HPLC), solid mouse, rat pricing
A9719 Arachidonyl-2′-chloroethylamide hydrate ≥97% (HPLC), oil mouse, rat pricing
T0397 L-Thyroxine sodium salt pentahydrate γ-irradiated, powder, BioXtra, suitable for cell culture mouse, rat pricing
T2501 L-Thyroxine sodium salt pentahydrate ≥98% (HPLC), powder mouse, rat pricing
M186 R(+)-Methanandamide 5 mg/mL in absolute ethanol, ≥96% (HPLC) mouse, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
C1112 CP-55940 >98% (HPLC), powder human, rat pricing
J4252 JWH-015 ≥98% (HPLC), powder human, rat pricing
P0359 Palmitoylethanolamide human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001841 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120781 MISSION® esiRNA esiRNA human CNR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001841 Rosetta Predictions human pricing
NM_020543 Rosetta Predictions rat pricing
NM_009924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041077 predicted 981
2 SASI_Hs02_00332649 predicted 703
3 SASI_Hs01_00041080 predicted 953
4 SASI_Hs01_00041081 predicted 1453
5 SASI_Hs02_00332650 predicted 1243
6 SASI_Hs01_00041082 predicted 1016
7 SASI_Hs01_00041083 predicted 583
8 SASI_Hs01_00041084 predicted 1224
9 SASI_Hs01_00041085 predicted 531
10 SASI_Hs01_00041086 predicted 734
11 SASI_Hs01_00041078 predicted 393
12 SASI_Hs01_00041079 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118756 predicted 997
2 SASI_Rn01_00118757 predicted 249
3 SASI_Rn01_00118759 predicted 253
4 SASI_Rn01_00118760 predicted 847
5 SASI_Rn01_00118761 predicted 367
6 SASI_Rn01_00118762 predicted 856
7 SASI_Rn01_00118763 predicted 290
8 SASI_Rn01_00118764 predicted 410
9 SASI_Rn01_00118765 predicted 702
10 SASI_Rn02_00262561 predicted 642
11 SASI_Rn01_00118758 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036037 predicted 1438
2 SASI_Mm01_00036038 predicted 1376
3 SASI_Mm01_00036041 predicted 488
4 SASI_Mm02_00317465 predicted 567
5 SASI_Mm02_00317466 predicted 1561
6 SASI_Mm01_00036042 predicted 1125
7 SASI_Mm01_00036043 predicted 1384
8 SASI_Mm01_00036044 predicted 811
9 SASI_Mm01_00036045 predicted 404
10 SASI_Mm01_00036046 predicted 893
11 SASI_Mm01_00036039 predicted 1469
12 SASI_Mm01_00036040 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009924
CNR2 MISSION shRNA Bacterial Glycerol Stock
cannabinoid receptor 2 (macrophage)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-1047s1c1
Sequence:CCGGCCTTGTTAACTCTATGGTCAACTCGAGTTGACCATAGAGTTAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-444s1c1
Sequence:CCGGCGCCTGCAACTTTGTCATCTTCTCGAGAAGATGACAAAGTTGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-660s1c1
Sequence:CCGGCCTCTCAGCATTGATTTCTTACTCGAGTAAGAAATCAATGCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-573s1c1
Sequence:CCGGCCGCTACCTATGTCTGTGTTACTCGAGTAACACAGACATAGGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009924.2-1778s1c1
Sequence:CCGGGCAAGAATTATGATGCCCTAACTCGAGTTAGGGCATCATAATTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009924
CNR2 MISSION shRNA shRNA Plasmid DNA
cannabinoid receptor 2 (macrophage)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-1047s1c1
Sequence:CCGGCCTTGTTAACTCTATGGTCAACTCGAGTTGACCATAGAGTTAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-444s1c1
Sequence:CCGGCGCCTGCAACTTTGTCATCTTCTCGAGAAGATGACAAAGTTGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-660s1c1
Sequence:CCGGCCTCTCAGCATTGATTTCTTACTCGAGTAAGAAATCAATGCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-573s1c1
Sequence:CCGGCCGCTACCTATGTCTGTGTTACTCGAGTAACACAGACATAGGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009924.2-1778s1c1
Sequence:CCGGGCAAGAATTATGATGCCCTAACTCGAGTTAGGGCATCATAATTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009924
CNR2 MISSION shRNA Lentiviral Transduction Particles
cannabinoid receptor 2 (macrophage)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-1047s1c1
Sequence:CCGGCCTTGTTAACTCTATGGTCAACTCGAGTTGACCATAGAGTTAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-444s1c1
Sequence:CCGGCGCCTGCAACTTTGTCATCTTCTCGAGAAGATGACAAAGTTGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-660s1c1
Sequence:CCGGCCTCTCAGCATTGATTTCTTACTCGAGTAAGAAATCAATGCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009924.2-573s1c1
Sequence:CCGGCCGCTACCTATGTCTGTGTTACTCGAGTAACACAGACATAGGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009924.2-1778s1c1
Sequence:CCGGGCAAGAATTATGATGCCCTAACTCGAGTTAGGGCATCATAATTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001841
CNR2 MISSION shRNA Bacterial Glycerol Stock
cannabinoid receptor 2 (macrophage)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001841.1-1618s1c1
Sequence:CCGGCCAGGTCTTCTCTCTGCCTAACTCGAGTTAGGCAGAGAGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-990s1c1
Sequence:CCGGCCTCATCAACTCCATGGTCAACTCGAGTTGACCATGGAGTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-733s1c1
Sequence:CCGGTCCGGAATCATCTACACCTATCTCGAGATAGGTGTAGATGATTCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-391s1c1
Sequence:CCGGTGCAGCTTTGTGAATTTCCATCTCGAGATGGAAATTCACAAAGCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-174s1c1
Sequence:CCGGCTTGGATTCCAACCCTATGAACTCGAGTTCATAGGGTTGGAATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001841.2-1282s21c1
Sequence:CCGGTGGCACTCTCTTCTTACTTAACTCGAGTTAAGTAAGAAGAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001841.2-534s21c1
Sequence:CCGGGCTATCCACCTTCCTACAAAGCTCGAGCTTTGTAGGAAGGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001841.2-1211s21c1
Sequence:CCGGTGAGGCCTCTTCCCAATTTAACTCGAGTTAAATTGGGAAGAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001841.2-389s21c1
Sequence:CCGGGCATGCAGCTTTGTGAATTTCCTCGAGGAAATTCACAAAGCTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001841
CNR2 MISSION shRNA shRNA Plasmid DNA
cannabinoid receptor 2 (macrophage)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001841.1-1618s1c1
Sequence:CCGGCCAGGTCTTCTCTCTGCCTAACTCGAGTTAGGCAGAGAGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-990s1c1
Sequence:CCGGCCTCATCAACTCCATGGTCAACTCGAGTTGACCATGGAGTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-733s1c1
Sequence:CCGGTCCGGAATCATCTACACCTATCTCGAGATAGGTGTAGATGATTCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-391s1c1
Sequence:CCGGTGCAGCTTTGTGAATTTCCATCTCGAGATGGAAATTCACAAAGCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-174s1c1
Sequence:CCGGCTTGGATTCCAACCCTATGAACTCGAGTTCATAGGGTTGGAATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001841.2-1282s21c1
Sequence:CCGGTGGCACTCTCTTCTTACTTAACTCGAGTTAAGTAAGAAGAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001841.2-534s21c1
Sequence:CCGGGCTATCCACCTTCCTACAAAGCTCGAGCTTTGTAGGAAGGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001841.2-1211s21c1
Sequence:CCGGTGAGGCCTCTTCCCAATTTAACTCGAGTTAAATTGGGAAGAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001841.2-389s21c1
Sequence:CCGGGCATGCAGCTTTGTGAATTTCCTCGAGGAAATTCACAAAGCTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001841
CNR2 MISSION shRNA Lentiviral Transduction Particles
cannabinoid receptor 2 (macrophage)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001841.1-1618s1c1
Sequence:CCGGCCAGGTCTTCTCTCTGCCTAACTCGAGTTAGGCAGAGAGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-990s1c1
Sequence:CCGGCCTCATCAACTCCATGGTCAACTCGAGTTGACCATGGAGTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-733s1c1
Sequence:CCGGTCCGGAATCATCTACACCTATCTCGAGATAGGTGTAGATGATTCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-391s1c1
Sequence:CCGGTGCAGCTTTGTGAATTTCCATCTCGAGATGGAAATTCACAAAGCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001841.1-174s1c1
Sequence:CCGGCTTGGATTCCAACCCTATGAACTCGAGTTCATAGGGTTGGAATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001841.2-1282s21c1
Sequence:CCGGTGGCACTCTCTTCTTACTTAACTCGAGTTAAGTAAGAAGAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001841.2-534s21c1
Sequence:CCGGGCTATCCACCTTCCTACAAAGCTCGAGCTTTGTAGGAAGGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001841.2-1211s21c1
Sequence:CCGGTGAGGCCTCTTCCCAATTTAACTCGAGTTAAATTGGGAAGAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001841.2-389s21c1
Sequence:CCGGGCATGCAGCTTTGTGAATTTCCTCGAGGAAATTCACAAAGCTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks