EMAIL THIS PAGE TO A FRIEND

CNRIP1

cannabinoid receptor interacting protein 1

Synonyms: C2orf32 CRIP1
UniProtKB ID: Q96F85, B2R4D0, Q49AN4, Q9UFZ0
Gene ID:
Human(25927) Summary: This gene encodes a protein that interacts with the C-terminal tail of cannabinoid receptor 1. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Mouse(380686) cannabinoid receptor interacting protein 1
Rat(364208) cannabinoid receptor interacting protein 1
chicken(421266) cannabinoid receptor interacting protein 1
cow(539715) cannabinoid receptor interacting protein 1
domestic cat(101090853) cannabinoid receptor interacting protein 1
dog(612567) uncharacterized LOC612567
domestic guinea pig(100730176) cannabinoid receptor interacting protein 1
naked mole-rat(101705907) cannabinoid receptor interacting protein 1
sheep(101110489) cannabinoid receptor interacting protein 1
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055121 MISSION® esiRNA esiRNA human CNRIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111101 Rosetta Predictions human pricing
NM_015463 Rosetta Predictions human pricing
NM_001014232 Rosetta Predictions rat pricing
NM_029861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325246 predicted 686
2 SASI_Hs02_00325247 predicted 659
3 SASI_Hs02_00325248 predicted 696
4 SASI_Hs02_00325249 predicted 679
5 SASI_Hs02_00325250 predicted 685
6 SASI_Hs02_00325251 predicted 658
7 SASI_Hs02_00325252 predicted 695
8 SASI_Hs02_00325253 predicted 754
9 SASI_Hs02_00325254 predicted 655
10 SASI_Hs02_00325255 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347880 predicted 687
2 SASI_Hs02_00347881 predicted 662
3 SASI_Hs01_00204420 predicted 702
4 SASI_Hs02_00347882 predicted 687
5 SASI_Hs02_00347883 predicted 684
6 SASI_Hs02_00347884 predicted 660
7 SASI_Hs02_00347885 predicted 693
8 SASI_Hs02_00347886 predicted 749
9 SASI_Hs02_00347887 predicted 664
10 SASI_Hs02_00347888 predicted 1472
11 SASI_Hs01_00204411 predicted 664
12 SASI_Hs01_00204412 predicted 877
13 SASI_Hs01_00204413 predicted 651
14 SASI_Hs01_00204414 predicted 876
15 SASI_Hs01_00204415 predicted 771
16 SASI_Hs01_00204416 predicted 558
17 SASI_Hs01_00204417 predicted 769
18 SASI_Hs01_00204418 predicted 678
19 SASI_Hs01_00204419 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056558 predicted 994
2 SASI_Rn01_00056559 predicted 907
3 SASI_Rn01_00056560 predicted 906
4 SASI_Rn02_00201773 predicted 1081
5 SASI_Rn01_00056561 predicted 775
6 SASI_Rn01_00056562 predicted 680
7 SASI_Rn01_00056563 predicted 707
8 SASI_Rn01_00056564 predicted 1106
9 SASI_Rn01_00056565 predicted 904
10 SASI_Rn01_00056567 predicted 973
11 SASI_Rn01_00056566 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336090 predicted 884
2 SASI_Mm01_00152850 predicted 590
3 SASI_Mm01_00152851 predicted 761
4 SASI_Mm01_00152852 predicted 783
5 SASI_Mm01_00152853 predicted 948
6 SASI_Mm01_00152854 predicted 882
7 SASI_Mm01_00152855 predicted 891
8 SASI_Mm01_00152856 predicted 568
9 SASI_Mm01_00152858 predicted 378
10 SASI_Mm01_00152859 predicted 574
11 SASI_Mm01_00152857 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015463
CNRIP1 MISSION shRNA Bacterial Glycerol Stock
cannabinoid receptor interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015463.2-1388s21c1
Sequence:CCGGTCCAGTTGTTCTCGGTCATACCTCGAGGTATGACCGAGAACAACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015463.2-791s21c1
Sequence:CCGGAGGTTGAGGTGAAGATTAAACCTCGAGGTTTAATCTTCACCTCAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015463.2-1200s21c1
Sequence:CCGGTAAACCAGCGCAGGCCTTAAACTCGAGTTTAAGGCCTGCGCTGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015463.1-482s1c1
Sequence:CCGGGCAGGTCGAGAATATTTCCATCTCGAGATGGAAATATTCTCGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-483s1c1
Sequence:CCGGCAGGTCGAGAATATTTCCATTCTCGAGAATGGAAATATTCTCGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-556s1c1
Sequence:CCGGGAGTTGTTTATACGGGTACATCTCGAGATGTACCCGTATAAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015463.1-461s1c1
Sequence:CCGGGAAGATTAAACCCAGCACGCTCTCGAGAGCGTGCTGGGTTTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-689s1c1
Sequence:CCGGCAATTACCACAAGCGGGATCACTCGAGTGATCCCGCTTGTGGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015463.1-1304s1c1
Sequence:CCGGCAGCAGTGAATGGGACTCAAACTCGAGTTTGAGTCCCATTCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015463.1-1130s1c1
Sequence:CCGGCCACTGACTAACTTTGGTGTTCTCGAGAACACCAAAGTTAGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015463
CNRIP1 MISSION shRNA shRNA Plasmid DNA
cannabinoid receptor interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015463.2-1388s21c1
Sequence:CCGGTCCAGTTGTTCTCGGTCATACCTCGAGGTATGACCGAGAACAACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015463.2-791s21c1
Sequence:CCGGAGGTTGAGGTGAAGATTAAACCTCGAGGTTTAATCTTCACCTCAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015463.2-1200s21c1
Sequence:CCGGTAAACCAGCGCAGGCCTTAAACTCGAGTTTAAGGCCTGCGCTGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015463.1-482s1c1
Sequence:CCGGGCAGGTCGAGAATATTTCCATCTCGAGATGGAAATATTCTCGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-483s1c1
Sequence:CCGGCAGGTCGAGAATATTTCCATTCTCGAGAATGGAAATATTCTCGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-556s1c1
Sequence:CCGGGAGTTGTTTATACGGGTACATCTCGAGATGTACCCGTATAAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015463.1-461s1c1
Sequence:CCGGGAAGATTAAACCCAGCACGCTCTCGAGAGCGTGCTGGGTTTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-689s1c1
Sequence:CCGGCAATTACCACAAGCGGGATCACTCGAGTGATCCCGCTTGTGGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015463.1-1304s1c1
Sequence:CCGGCAGCAGTGAATGGGACTCAAACTCGAGTTTGAGTCCCATTCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015463.1-1130s1c1
Sequence:CCGGCCACTGACTAACTTTGGTGTTCTCGAGAACACCAAAGTTAGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015463
CNRIP1 MISSION shRNA Lentiviral Transduction Particles
cannabinoid receptor interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015463.2-1388s21c1
Sequence:CCGGTCCAGTTGTTCTCGGTCATACCTCGAGGTATGACCGAGAACAACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015463.2-791s21c1
Sequence:CCGGAGGTTGAGGTGAAGATTAAACCTCGAGGTTTAATCTTCACCTCAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015463.2-1200s21c1
Sequence:CCGGTAAACCAGCGCAGGCCTTAAACTCGAGTTTAAGGCCTGCGCTGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015463.1-482s1c1
Sequence:CCGGGCAGGTCGAGAATATTTCCATCTCGAGATGGAAATATTCTCGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-483s1c1
Sequence:CCGGCAGGTCGAGAATATTTCCATTCTCGAGAATGGAAATATTCTCGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-556s1c1
Sequence:CCGGGAGTTGTTTATACGGGTACATCTCGAGATGTACCCGTATAAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015463.1-461s1c1
Sequence:CCGGGAAGATTAAACCCAGCACGCTCTCGAGAGCGTGCTGGGTTTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015463.1-689s1c1
Sequence:CCGGCAATTACCACAAGCGGGATCACTCGAGTGATCCCGCTTGTGGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015463.1-1304s1c1
Sequence:CCGGCAGCAGTGAATGGGACTCAAACTCGAGTTTGAGTCCCATTCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015463.1-1130s1c1
Sequence:CCGGCCACTGACTAACTTTGGTGTTCTCGAGAACACCAAAGTTAGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029861
CNRIP1 MISSION shRNA Bacterial Glycerol Stock
cannabinoid receptor interacting protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029861.1-1216s1c1
Sequence:CCGGCCAAATGTTGTGCTTCCTATTCTCGAGAATAGGAAGCACAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-417s1c1
Sequence:CCGGGAACATTTCCATTGGTGGTGTCTCGAGACACCACCAATGGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-408s1c1
Sequence:CCGGGCAGGTCGAGAACATTTCCATCTCGAGATGGAAATGTTCTCGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-667s1c1
Sequence:CCGGGAGTATGAATGCAAGCCCAATCTCGAGATTGGGCTTGCATTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029861
CNRIP1 MISSION shRNA shRNA Plasmid DNA
cannabinoid receptor interacting protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029861.1-1216s1c1
Sequence:CCGGCCAAATGTTGTGCTTCCTATTCTCGAGAATAGGAAGCACAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-417s1c1
Sequence:CCGGGAACATTTCCATTGGTGGTGTCTCGAGACACCACCAATGGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-408s1c1
Sequence:CCGGGCAGGTCGAGAACATTTCCATCTCGAGATGGAAATGTTCTCGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-667s1c1
Sequence:CCGGGAGTATGAATGCAAGCCCAATCTCGAGATTGGGCTTGCATTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029861
CNRIP1 MISSION shRNA Lentiviral Transduction Particles
cannabinoid receptor interacting protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029861.1-1216s1c1
Sequence:CCGGCCAAATGTTGTGCTTCCTATTCTCGAGAATAGGAAGCACAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-417s1c1
Sequence:CCGGGAACATTTCCATTGGTGGTGTCTCGAGACACCACCAATGGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-408s1c1
Sequence:CCGGGCAGGTCGAGAACATTTCCATCTCGAGATGGAAATGTTCTCGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029861.1-667s1c1
Sequence:CCGGGAGTATGAATGCAAGCCCAATCTCGAGATTGGGCTTGCATTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks