EMAIL THIS PAGE TO A FRIEND

CNST

consortin, connexin sorting protein

89 Gene Product Result for
Synonyms: C1orf71 PPP1R64
Gene ID:
Human(163882) Summary: Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]
Mouse(226744) consortin, connexin sorting protein
Rat(498297) consortin, connexin sorting protein
chicken(421487) consortin, connexin sorting protein
dog(611848) consortin, connexin sorting protein
domestic cat(101088971) consortin, connexin sorting protein
cow(541076) consortin, connexin sorting protein
Horse(100054634) consortin, connexin sorting protein
sheep(101115637) consortin, connexin sorting protein
naked mole-rat(101721862) consortin, connexin sorting protein
domestic guinea pig(100730837) consortin, connexin sorting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152609 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152609 Rosetta Predictions human pricing
XM_001060344 Rosetta Predictions rat pricing
XM_573525 Rosetta Predictions rat pricing
NM_146105 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091868 predicted 1952
2 SASI_Hs02_00366460 predicted 836
3 SASI_Hs01_00091869 predicted 2053
4 SASI_Hs01_00091870 predicted 1226
5 SASI_Hs01_00091871 predicted 2029
6 SASI_Hs01_00091872 predicted 2148
7 SASI_Hs01_00091873 predicted 1078
8 SASI_Hs01_00091874 predicted 1129
9 SASI_Hs01_00091875 predicted 2123
10 SASI_Hs01_00091876 predicted 938
11 SASI_Hs01_00091867 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296110 predicted 543
2 SASI_Rn02_00296111 predicted 876
3 SASI_Rn02_00296112 predicted 1751
4 SASI_Rn02_00296113 predicted 894
5 SASI_Rn02_00296114 predicted 1178
6 SASI_Rn02_00296115 predicted 2182
7 SASI_Rn02_00296116 predicted 245
8 SASI_Rn02_00296117 predicted 2373
9 SASI_Rn02_00296118 predicted 664
10 SASI_Rn02_00296119 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400454 predicted 547
2 SASI_Rn02_00400455 predicted 875
3 SASI_Rn02_00400456 predicted 1745
4 SASI_Rn02_00400457 predicted 894
5 SASI_Rn02_00400458 predicted 1171
6 SASI_Rn02_00400459 predicted 2181
7 SASI_Rn02_00400460 predicted 246
8 SASI_Rn02_00400461 predicted 2372
9 SASI_Rn02_00400462 predicted 668
10 SASI_Rn02_00400463 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117571 predicted 1003
2 SASI_Mm01_00117572 predicted 738
3 SASI_Mm01_00117573 predicted 989
4 SASI_Mm01_00117574 predicted 1038
5 SASI_Mm01_00117575 predicted 709
6 SASI_Mm01_00117576 predicted 522
7 SASI_Mm01_00117577 predicted 770
8 SASI_Mm01_00117578 predicted 1429
9 SASI_Mm01_00117579 predicted 1051
10 SASI_Mm02_00341751 predicted 756
11 SASI_Mm01_00117580 predicted 1715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146105
VALIDATED
CNST MISSION shRNA Bacterial Glycerol Stock
consortin, connexin sorting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146105.3-777s1c1
Sequence:CCGGGAGCAATTGCTTGCAAATCTTCTCGAGAAGATTTGCAAGCAATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-2207s1c1
Sequence:CCGGCGTGGACTTCTATTACACTAACTCGAGTTAGTGTAATAGAAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-996s1c1
Sequence:CCGGGCAAGGGCGATAATGTCTGAACTCGAGTTCAGACATTATCGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146105.3-4191s1c1
Sequence:CCGGGCTGAAATGATACCTGGCTAACTCGAGTTAGCCAGGTATCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-2167s1c1
Sequence:CCGGGCAACATTGAGTCACCTGTTTCTCGAGAAACAGGTGACTCAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-2579s1c1
Sequence:CCGGCCCACCATCATGCAATAAGTTCTCGAGAACTTATTGCATGATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-341s1c1
Sequence:CCGGCAGTCTCAACAATAACGAAAGCTCGAGCTTTCGTTATTGTTGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-746s1c1
Sequence:CCGGGAAATTTATTCAGCTTGAAAGCTCGAGCTTTCAAGCTGAATAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146105
VALIDATED
CNST MISSION shRNA shRNA Plasmid DNA
consortin, connexin sorting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146105.3-777s1c1
Sequence:CCGGGAGCAATTGCTTGCAAATCTTCTCGAGAAGATTTGCAAGCAATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-2207s1c1
Sequence:CCGGCGTGGACTTCTATTACACTAACTCGAGTTAGTGTAATAGAAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-996s1c1
Sequence:CCGGGCAAGGGCGATAATGTCTGAACTCGAGTTCAGACATTATCGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146105.3-4191s1c1
Sequence:CCGGGCTGAAATGATACCTGGCTAACTCGAGTTAGCCAGGTATCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-2167s1c1
Sequence:CCGGGCAACATTGAGTCACCTGTTTCTCGAGAAACAGGTGACTCAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-2579s1c1
Sequence:CCGGCCCACCATCATGCAATAAGTTCTCGAGAACTTATTGCATGATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-341s1c1
Sequence:CCGGCAGTCTCAACAATAACGAAAGCTCGAGCTTTCGTTATTGTTGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-746s1c1
Sequence:CCGGGAAATTTATTCAGCTTGAAAGCTCGAGCTTTCAAGCTGAATAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146105
VALIDATED
CNST MISSION shRNA Lentiviral Transduction Particles
consortin, connexin sorting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146105.3-777s1c1
Sequence:CCGGGAGCAATTGCTTGCAAATCTTCTCGAGAAGATTTGCAAGCAATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-2207s1c1
Sequence:CCGGCGTGGACTTCTATTACACTAACTCGAGTTAGTGTAATAGAAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-996s1c1
Sequence:CCGGGCAAGGGCGATAATGTCTGAACTCGAGTTCAGACATTATCGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146105.3-4191s1c1
Sequence:CCGGGCTGAAATGATACCTGGCTAACTCGAGTTAGCCAGGTATCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-2167s1c1
Sequence:CCGGGCAACATTGAGTCACCTGTTTCTCGAGAAACAGGTGACTCAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146105.3-2579s1c1
Sequence:CCGGCCCACCATCATGCAATAAGTTCTCGAGAACTTATTGCATGATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-341s1c1
Sequence:CCGGCAGTCTCAACAATAACGAAAGCTCGAGCTTTCGTTATTGTTGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146105.3-746s1c1
Sequence:CCGGGAAATTTATTCAGCTTGAAAGCTCGAGCTTTCAAGCTGAATAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152609
VALIDATED
CNST MISSION shRNA Bacterial Glycerol Stock
consortin, connexin sorting protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-938s1c1
Sequence:CCGGCCACATACAGTTACGGCTCTACTCGAGTAGAGCCGTAACTGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-2820s1c1
Sequence:CCGGCCTTATGGTTTCAGTGTCATTCTCGAGAATGACACTGAAACCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-1544s1c1
Sequence:CCGGGCATTGATTTCTGAGGGTAAACTCGAGTTTACCCTCAGAAATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152609.1-2155s1c1
Sequence:CCGGCCAAGAAATAGACGATAGCTTCTCGAGAAGCTATCGTCTATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152609.1-3243s1c1
Sequence:CCGGGCAAACGCTTACACCTATTATCTCGAGATAATAGGTGTAAGCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152609
VALIDATED
CNST MISSION shRNA shRNA Plasmid DNA
consortin, connexin sorting protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-938s1c1
Sequence:CCGGCCACATACAGTTACGGCTCTACTCGAGTAGAGCCGTAACTGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-2820s1c1
Sequence:CCGGCCTTATGGTTTCAGTGTCATTCTCGAGAATGACACTGAAACCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-1544s1c1
Sequence:CCGGGCATTGATTTCTGAGGGTAAACTCGAGTTTACCCTCAGAAATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152609.1-2155s1c1
Sequence:CCGGCCAAGAAATAGACGATAGCTTCTCGAGAAGCTATCGTCTATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152609.1-3243s1c1
Sequence:CCGGGCAAACGCTTACACCTATTATCTCGAGATAATAGGTGTAAGCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152609
VALIDATED
CNST MISSION shRNA Lentiviral Transduction Particles
consortin, connexin sorting protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-938s1c1
Sequence:CCGGCCACATACAGTTACGGCTCTACTCGAGTAGAGCCGTAACTGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-2820s1c1
Sequence:CCGGCCTTATGGTTTCAGTGTCATTCTCGAGAATGACACTGAAACCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152609.1-1544s1c1
Sequence:CCGGGCATTGATTTCTGAGGGTAAACTCGAGTTTACCCTCAGAAATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152609.1-2155s1c1
Sequence:CCGGCCAAGAAATAGACGATAGCTTCTCGAGAAGCTATCGTCTATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152609.1-3243s1c1
Sequence:CCGGGCAAACGCTTACACCTATTATCTCGAGATAATAGGTGTAAGCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks