EMAIL THIS PAGE TO A FRIEND

CNTD1

cyclin N-terminal domain containing 1

122 Gene Product Result for
Synonyms: CNTD
UniProtKB ID: Q8N815, Q658Q6, Q8NEP1
Gene ID:
Mouse(68107) cyclin N-terminal domain containing 1
Rat(498001) cyclin N-terminal domain containing 1
chicken(420019) cyclin N-terminal domain containing 1
cow(100847608) cyclin N-terminal domain containing 1
domestic cat(101100769) cyclin N-terminal domain containing 1
dog(490958) cyclin N-terminal domain containing 1
domestic guinea pig(100719865) cyclin N-terminal domain containing 1
naked mole-rat(101722376) cyclin N-terminal domain containing 1
sheep(101105930) cyclin N-terminal domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173478 Rosetta Predictions human pricing
XM_001081478 Rosetta Predictions rat pricing
XM_573197 Rosetta Predictions rat pricing
NM_026562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016225 predicted 1271
2 SASI_Hs01_00016226 predicted 512
3 SASI_Hs01_00016227 predicted 687
4 SASI_Hs01_00016228 predicted 1226
5 SASI_Hs01_00016229 predicted 618
6 SASI_Hs01_00016231 predicted 744
7 SASI_Hs01_00016233 predicted 467
8 SASI_Hs02_00368235 predicted 296
9 SASI_Hs01_00016234 predicted 547
10 SASI_Hs02_00368236 predicted 715
11 SASI_Hs01_00016230 predicted 997
12 SASI_Hs01_00016232 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372070 predicted 449
2 SASI_Rn02_00372071 predicted 500
3 SASI_Rn02_00372072 predicted 257
4 SASI_Rn02_00372073 predicted 212
5 SASI_Rn02_00372074 predicted 385
6 SASI_Rn02_00372075 predicted 466
7 SASI_Rn02_00372076 predicted 657
8 SASI_Rn02_00372077 predicted 475
9 SASI_Rn02_00372078 predicted 413
10 SASI_Rn02_00372079 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399974 predicted 450
2 SASI_Rn02_00399975 predicted 505
3 SASI_Rn02_00399976 predicted 256
4 SASI_Rn02_00399977 predicted 216
5 SASI_Rn02_00399978 predicted 378
6 SASI_Rn02_00399979 predicted 464
7 SASI_Rn02_00399980 predicted 651
8 SASI_Rn02_00399981 predicted 479
9 SASI_Rn02_00399982 predicted 415
10 SASI_Rn02_00399983 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031527 predicted 325
2 SASI_Mm01_00031528 predicted 564
3 SASI_Mm01_00031529 predicted 432
4 SASI_Mm01_00031530 predicted 589
5 SASI_Mm01_00031531 predicted 530
6 SASI_Mm01_00031532 predicted 909
7 SASI_Mm01_00031533 predicted 481
8 SASI_Mm01_00031534 predicted 770
9 SASI_Mm01_00031535 predicted 971
10 SASI_Mm01_00031536 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173478
CNTD1 MISSION shRNA Bacterial Glycerol Stock
cyclin N-terminal domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173478.2-993s21c1
Sequence:CCGGTGTTGGCAGTAGGAATCATTGCTCGAGCAATGATTCCTACTGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173478.2-1619s21c1
Sequence:CCGGTAACATCTCTGTTCCATTATTCTCGAGAATAATGGAACAGAGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173478.2-745s21c1
Sequence:CCGGGTCCTTGAACTTCCGAATTAACTCGAGTTAATTCGGAAGTTCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-2015s1c1
Sequence:CCGGGCAGGAAGTTGAGAGAGATAACTCGAGTTATCTCTCTCAACTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173478.1-540s1c1
Sequence:CCGGCCAGCAAACTTTCCTTCCGAACTCGAGTTCGGAAGGAAAGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1192s1c1
Sequence:CCGGCCTCCCTCTGTTTACTTTCATCTCGAGATGAAAGTAAACAGAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1154s1c1
Sequence:CCGGCCACCAAATATAAACAGCCATCTCGAGATGGCTGTTTATATTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1686s1c1
Sequence:CCGGCCCAGAATACAAAGTACTCTACTCGAGTAGAGTACTTTGTATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173478.1-658s1c1
Sequence:CCGGGAAGTCCTTGAACTTCCGAATCTCGAGATTCGGAAGTTCAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173478
CNTD1 MISSION shRNA shRNA Plasmid DNA
cyclin N-terminal domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173478.2-993s21c1
Sequence:CCGGTGTTGGCAGTAGGAATCATTGCTCGAGCAATGATTCCTACTGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173478.2-1619s21c1
Sequence:CCGGTAACATCTCTGTTCCATTATTCTCGAGAATAATGGAACAGAGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173478.2-745s21c1
Sequence:CCGGGTCCTTGAACTTCCGAATTAACTCGAGTTAATTCGGAAGTTCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-2015s1c1
Sequence:CCGGGCAGGAAGTTGAGAGAGATAACTCGAGTTATCTCTCTCAACTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173478.1-540s1c1
Sequence:CCGGCCAGCAAACTTTCCTTCCGAACTCGAGTTCGGAAGGAAAGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1192s1c1
Sequence:CCGGCCTCCCTCTGTTTACTTTCATCTCGAGATGAAAGTAAACAGAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1154s1c1
Sequence:CCGGCCACCAAATATAAACAGCCATCTCGAGATGGCTGTTTATATTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1686s1c1
Sequence:CCGGCCCAGAATACAAAGTACTCTACTCGAGTAGAGTACTTTGTATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173478.1-658s1c1
Sequence:CCGGGAAGTCCTTGAACTTCCGAATCTCGAGATTCGGAAGTTCAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173478
CNTD1 MISSION shRNA Lentiviral Transduction Particles
cyclin N-terminal domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173478.2-993s21c1
Sequence:CCGGTGTTGGCAGTAGGAATCATTGCTCGAGCAATGATTCCTACTGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173478.2-1619s21c1
Sequence:CCGGTAACATCTCTGTTCCATTATTCTCGAGAATAATGGAACAGAGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173478.2-745s21c1
Sequence:CCGGGTCCTTGAACTTCCGAATTAACTCGAGTTAATTCGGAAGTTCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-2015s1c1
Sequence:CCGGGCAGGAAGTTGAGAGAGATAACTCGAGTTATCTCTCTCAACTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173478.1-540s1c1
Sequence:CCGGCCAGCAAACTTTCCTTCCGAACTCGAGTTCGGAAGGAAAGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1192s1c1
Sequence:CCGGCCTCCCTCTGTTTACTTTCATCTCGAGATGAAAGTAAACAGAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1154s1c1
Sequence:CCGGCCACCAAATATAAACAGCCATCTCGAGATGGCTGTTTATATTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173478.1-1686s1c1
Sequence:CCGGCCCAGAATACAAAGTACTCTACTCGAGTAGAGTACTTTGTATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173478.1-658s1c1
Sequence:CCGGGAAGTCCTTGAACTTCCGAATCTCGAGATTCGGAAGTTCAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026562
CNTD1 MISSION shRNA Bacterial Glycerol Stock
cyclin N-terminal domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-133s21c1
Sequence:CCGGGCTGGTGAACTGTAGTGACTTCTCGAGAAGTCACTACAGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-266s21c1
Sequence:CCGGACCCGGATCGTGGAGTTTGTTCTCGAGAACAAACTCCACGATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-168s21c1
Sequence:CCGGTTACCACAGAGACTATCGAAACTCGAGTTTCGATAGTCTCTGTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-141s21c1
Sequence:CCGGACTGTAGTGACTTTCAGTTCGCTCGAGCGAACTGAAAGTCACTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-151s21c1
Sequence:CCGGCTTTCAGTTCGGAGTGGTTACCTCGAGGTAACCACTCCGAACTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026562
CNTD1 MISSION shRNA shRNA Plasmid DNA
cyclin N-terminal domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-133s21c1
Sequence:CCGGGCTGGTGAACTGTAGTGACTTCTCGAGAAGTCACTACAGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-266s21c1
Sequence:CCGGACCCGGATCGTGGAGTTTGTTCTCGAGAACAAACTCCACGATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-168s21c1
Sequence:CCGGTTACCACAGAGACTATCGAAACTCGAGTTTCGATAGTCTCTGTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-141s21c1
Sequence:CCGGACTGTAGTGACTTTCAGTTCGCTCGAGCGAACTGAAAGTCACTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-151s21c1
Sequence:CCGGCTTTCAGTTCGGAGTGGTTACCTCGAGGTAACCACTCCGAACTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026562
CNTD1 MISSION shRNA Lentiviral Transduction Particles
cyclin N-terminal domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-133s21c1
Sequence:CCGGGCTGGTGAACTGTAGTGACTTCTCGAGAAGTCACTACAGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-266s21c1
Sequence:CCGGACCCGGATCGTGGAGTTTGTTCTCGAGAACAAACTCCACGATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-168s21c1
Sequence:CCGGTTACCACAGAGACTATCGAAACTCGAGTTTCGATAGTCTCTGTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-141s21c1
Sequence:CCGGACTGTAGTGACTTTCAGTTCGCTCGAGCGAACTGAAAGTCACTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026562.2-151s21c1
Sequence:CCGGCTTTCAGTTCGGAGTGGTTACCTCGAGGTAACCACTCCGAACTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks