EMAIL THIS PAGE TO A FRIEND

CNTD2

cyclin N-terminal domain containing 2

41 Gene Product Result for
UniProtKB ID: Q9H8S5, B4DX65
Gene ID:
sheep(101118980) cyclin N-terminal domain containing 2
naked mole-rat(101714306) cyclin N-terminal domain containing 2
domestic guinea pig(100717144) cyclin N-terminal domain containing 2
domestic cat(101089481) cyclin N-terminal domain containing 2
cow(613755) cyclin N-terminal domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024877 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024877 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052248 predicted 301
2 SASI_Hs01_00052254 predicted 690
3 SASI_Hs02_00357476 predicted 262
4 SASI_Hs01_00052250 predicted 889
5 SASI_Hs01_00052251 predicted 921
6 SASI_Hs01_00052249 predicted 829
7 SASI_Hs01_00052252 predicted 889
8 SASI_Hs01_00052253 predicted 918
9 SASI_Hs01_00052255 predicted 832
10 SASI_Hs01_00052256 predicted 299
11 SASI_Hs01_00052257 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024877
CNTD2 MISSION shRNA Bacterial Glycerol Stock
cyclin N-terminal domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-697s1c1
Sequence:CCGGGATGTTACTTGCCACCTACTTCTCGAGAAGTAGGTGGCAAGTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-833s1c1
Sequence:CCGGCCAGAACTTTACAGGTGTAGTCTCGAGACTACACCTGTAAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-893s1c1
Sequence:CCGGGACTTACCTTCCTGGTCATTTCTCGAGAAATGACCAGGAAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024877.1-305s1c1
Sequence:CCGGGACACACTTTATCTGGCGGTTCTCGAGAACCGCCAGATAAAGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-919s1c1
Sequence:CCGGGTCTCGGAGAATGAGAGACAACTCGAGTTGTCTCTCATTCTCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024877.3-1094s21c1
Sequence:CCGGGCCCAGAAGATGCTCCTATTGCTCGAGCAATAGGAGCATCTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024877.3-517s21c1
Sequence:CCGGTTGCCTGTTTGTGGCGTGCAACTCGAGTTGCACGCCACAAACAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024877.3-1450s21c1
Sequence:CCGGGGAACCACATCGACGCTTCTTCTCGAGAAGAAGCGTCGATGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024877
CNTD2 MISSION shRNA shRNA Plasmid DNA
cyclin N-terminal domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-697s1c1
Sequence:CCGGGATGTTACTTGCCACCTACTTCTCGAGAAGTAGGTGGCAAGTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-833s1c1
Sequence:CCGGCCAGAACTTTACAGGTGTAGTCTCGAGACTACACCTGTAAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-893s1c1
Sequence:CCGGGACTTACCTTCCTGGTCATTTCTCGAGAAATGACCAGGAAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024877.1-305s1c1
Sequence:CCGGGACACACTTTATCTGGCGGTTCTCGAGAACCGCCAGATAAAGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-919s1c1
Sequence:CCGGGTCTCGGAGAATGAGAGACAACTCGAGTTGTCTCTCATTCTCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024877.3-1094s21c1
Sequence:CCGGGCCCAGAAGATGCTCCTATTGCTCGAGCAATAGGAGCATCTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024877.3-517s21c1
Sequence:CCGGTTGCCTGTTTGTGGCGTGCAACTCGAGTTGCACGCCACAAACAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024877.3-1450s21c1
Sequence:CCGGGGAACCACATCGACGCTTCTTCTCGAGAAGAAGCGTCGATGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024877
CNTD2 MISSION shRNA Lentiviral Transduction Particles
cyclin N-terminal domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-697s1c1
Sequence:CCGGGATGTTACTTGCCACCTACTTCTCGAGAAGTAGGTGGCAAGTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-833s1c1
Sequence:CCGGCCAGAACTTTACAGGTGTAGTCTCGAGACTACACCTGTAAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-893s1c1
Sequence:CCGGGACTTACCTTCCTGGTCATTTCTCGAGAAATGACCAGGAAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024877.1-305s1c1
Sequence:CCGGGACACACTTTATCTGGCGGTTCTCGAGAACCGCCAGATAAAGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024877.1-919s1c1
Sequence:CCGGGTCTCGGAGAATGAGAGACAACTCGAGTTGTCTCTCATTCTCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024877.3-1094s21c1
Sequence:CCGGGCCCAGAAGATGCTCCTATTGCTCGAGCAATAGGAGCATCTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024877.3-517s21c1
Sequence:CCGGTTGCCTGTTTGTGGCGTGCAACTCGAGTTGCACGCCACAAACAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024877.3-1450s21c1
Sequence:CCGGGGAACCACATCGACGCTTCTTCTCGAGAAGAAGCGTCGATGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks