EMAIL THIS PAGE TO A FRIEND

CNTF

ciliary neurotrophic factor

Synonyms: HCNTF
UniProtKB ID: P26441, B2RAB2
Gene ID:
Human(1270) Summary: The protein encoded by this gene is a polypeptide hormone whose actions appear to be restricted to the nervous system where it promotes neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. The protein is a potent survival factor for neurons and oligodendrocytes and may be relevant in reducing tissue destruction during inflammatory attacks. A mutation in this gene, which results in aberrant splicing, leads to ciliary neurotrophic factor deficiency, but this phenotype is not causally related to neurologic disease. A read-through transcript variant composed of the upstream ZFP91 gene and CNTF sequence has been identified, but it is thought to be non-coding. Read-through transcription of ZFP91 and CNTF has also been observed in mouse. [provided by RefSeq, Oct 2010]
Mouse(12803) ciliary neurotrophic factor
Rat(25707) ciliary neurotrophic factor
chicken(396488) ciliary neurotrophic factor
dog(483464) ciliary neurotrophic factor
cow(100848228) ciliary neurotrophic factor
domestic cat(101097592) ciliary neurotrophic factor
domestic guinea pig(100724905) ciliary neurotrophic factor
naked mole-rat(101713822) ciliary neurotrophic factor
Domestic Rabbit(100009117) ciliary neurotrophic factor
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000614 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000614 Rosetta Predictions human pricing
NM_013166 Rosetta Predictions rat pricing
NM_053007 Rosetta Predictions mouse pricing
NM_170786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089390 predicted 873
2 SASI_Hs01_00089391 predicted 286
3 SASI_Hs01_00089392 predicted 440
4 SASI_Hs02_00302932 predicted 547
5 SASI_Hs01_00089393 predicted 315
6 SASI_Hs02_00302933 predicted 291
7 SASI_Hs01_00089394 predicted 591
8 SASI_Hs01_00089395 predicted 493
9 SASI_Hs01_00089397 predicted 515
10 SASI_Hs02_00302934 predicted 488
11 SASI_Hs01_00089389 predicted 681
12 SASI_Hs01_00089396 predicted 772
13 SASI_Hs01_00089398 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066187 predicted 827
2 SASI_Rn01_00066188 predicted 383
3 SASI_Rn01_00066189 predicted 768
4 SASI_Rn01_00066191 predicted 805
5 SASI_Rn01_00066192 predicted 842
6 SASI_Rn01_00066193 predicted 337
7 SASI_Rn01_00066194 predicted 581
8 SASI_Rn01_00066195 predicted 862
9 SASI_Rn01_00066196 predicted 504
10 SASI_Rn02_00260989 predicted 383
11 SASI_Rn01_00066190 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026585 predicted 2631
2 SASI_Mm01_00026586 predicted 2880
3 SASI_Mm01_00026587 predicted 2702
4 SASI_Mm01_00026588 predicted 2625
5 SASI_Mm01_00026589 predicted 2902
6 SASI_Mm01_00026590 predicted 2964
7 SASI_Mm01_00026591 predicted 3120
8 SASI_Mm01_00026592 predicted 2690
9 SASI_Mm01_00026593 predicted 2745
10 SASI_Mm01_00026594 predicted 3070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094933 predicted 483
2 SASI_Mm01_00094934 predicted 732
3 SASI_Mm01_00094935 predicted 553
4 SASI_Mm01_00094936 predicted 473
5 SASI_Mm01_00094937 predicted 760
6 SASI_Mm01_00094938 predicted 755
7 SASI_Mm02_00343633 predicted 964
8 SASI_Mm01_00094939 predicted 822
9 SASI_Mm01_00094940 predicted 971
10 SASI_Mm01_00094941 predicted 589
11 SASI_Mm01_00094942 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000614
CNTF MISSION shRNA Bacterial Glycerol Stock
ciliary neurotrophic factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000614.3-387s21c1
Sequence:CCGGGGTGACTTCCATCAAGCTATACTCGAGTATAGCTTGATGGAAGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000614.3-1005s21c1
Sequence:CCGGGTAACCTCTACAGGCATTTAACTCGAGTTAAATGCCTGTAGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000614.3-828s21c1
Sequence:CCGGGTTGAAGGACTACAGGTATTTCTCGAGAAATACCTGTAGTCCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-439s1c1
Sequence:CCGGGCATACCAGATAGAGGAGTTACTCGAGTAACTCCTCTATCTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-651s1c1
Sequence:CCGGGAGCCATTATATTGCTAACAACTCGAGTTGTTAGCAATATAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-295s1c1
Sequence:CCGGCGACTCCAAGAGAACCTTCAACTCGAGTTGAAGGTTCTCTTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-430s1c1
Sequence:CCGGGCTGCCTTTGCATACCAGATACTCGAGTATCTGGTATGCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-174s1c1
Sequence:CCGGGACTGCTCTTACGGAATCCTACTCGAGTAGGATTCCGTAAGAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000614
CNTF MISSION shRNA shRNA Plasmid DNA
ciliary neurotrophic factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000614.3-387s21c1
Sequence:CCGGGGTGACTTCCATCAAGCTATACTCGAGTATAGCTTGATGGAAGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000614.3-1005s21c1
Sequence:CCGGGTAACCTCTACAGGCATTTAACTCGAGTTAAATGCCTGTAGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000614.3-828s21c1
Sequence:CCGGGTTGAAGGACTACAGGTATTTCTCGAGAAATACCTGTAGTCCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-439s1c1
Sequence:CCGGGCATACCAGATAGAGGAGTTACTCGAGTAACTCCTCTATCTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-651s1c1
Sequence:CCGGGAGCCATTATATTGCTAACAACTCGAGTTGTTAGCAATATAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-295s1c1
Sequence:CCGGCGACTCCAAGAGAACCTTCAACTCGAGTTGAAGGTTCTCTTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-430s1c1
Sequence:CCGGGCTGCCTTTGCATACCAGATACTCGAGTATCTGGTATGCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-174s1c1
Sequence:CCGGGACTGCTCTTACGGAATCCTACTCGAGTAGGATTCCGTAAGAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000614
CNTF MISSION shRNA Lentiviral Transduction Particles
ciliary neurotrophic factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000614.3-387s21c1
Sequence:CCGGGGTGACTTCCATCAAGCTATACTCGAGTATAGCTTGATGGAAGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000614.3-1005s21c1
Sequence:CCGGGTAACCTCTACAGGCATTTAACTCGAGTTAAATGCCTGTAGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000614.3-828s21c1
Sequence:CCGGGTTGAAGGACTACAGGTATTTCTCGAGAAATACCTGTAGTCCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-439s1c1
Sequence:CCGGGCATACCAGATAGAGGAGTTACTCGAGTAACTCCTCTATCTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-651s1c1
Sequence:CCGGGAGCCATTATATTGCTAACAACTCGAGTTGTTAGCAATATAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-295s1c1
Sequence:CCGGCGACTCCAAGAGAACCTTCAACTCGAGTTGAAGGTTCTCTTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-430s1c1
Sequence:CCGGGCTGCCTTTGCATACCAGATACTCGAGTATCTGGTATGCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000614.2-174s1c1
Sequence:CCGGGACTGCTCTTACGGAATCCTACTCGAGTAGGATTCCGTAAGAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170786
VALIDATED
CNTF MISSION shRNA Bacterial Glycerol Stock
ciliary neurotrophic factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-597s21c1
Sequence:CCGGCCTACCAGCTAGAGGAGTTAACTCGAGTTAACTCCTCTAGCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-554s21c1
Sequence:CCGGCATCAGGCAATACATACTCTTCTCGAGAAGAGTATGTATTGCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-386s21c1
Sequence:CCGGCTTGACTCAGTGGATGGTGTACTCGAGTACACCATCCACTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-335s21c1
Sequence:CCGGGCTCTTATGGAATCTTATGTACTCGAGTACATAAGATTCCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-386s1c1
Sequence:CCGGCTTGACTCAGTGGATGGTGTACTCGAGTACACCATCCACTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-597s1c1
Sequence:CCGGCCTACCAGCTAGAGGAGTTAACTCGAGTTAACTCCTCTAGCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-769s1c1
Sequence:CCGGTGTCATTTCTTCTCATCACATCTCGAGATGTGATGAGAAGAAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-554s1c1
Sequence:CCGGCATCAGGCAATACATACTCTTCTCGAGAAGAGTATGTATTGCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-335s1c1
Sequence:CCGGGCTCTTATGGAATCTTATGTACTCGAGTACATAAGATTCCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170786
VALIDATED
CNTF MISSION shRNA shRNA Plasmid DNA
ciliary neurotrophic factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-597s21c1
Sequence:CCGGCCTACCAGCTAGAGGAGTTAACTCGAGTTAACTCCTCTAGCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-554s21c1
Sequence:CCGGCATCAGGCAATACATACTCTTCTCGAGAAGAGTATGTATTGCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-386s21c1
Sequence:CCGGCTTGACTCAGTGGATGGTGTACTCGAGTACACCATCCACTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-335s21c1
Sequence:CCGGGCTCTTATGGAATCTTATGTACTCGAGTACATAAGATTCCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-386s1c1
Sequence:CCGGCTTGACTCAGTGGATGGTGTACTCGAGTACACCATCCACTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-597s1c1
Sequence:CCGGCCTACCAGCTAGAGGAGTTAACTCGAGTTAACTCCTCTAGCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-769s1c1
Sequence:CCGGTGTCATTTCTTCTCATCACATCTCGAGATGTGATGAGAAGAAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-554s1c1
Sequence:CCGGCATCAGGCAATACATACTCTTCTCGAGAAGAGTATGTATTGCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-335s1c1
Sequence:CCGGGCTCTTATGGAATCTTATGTACTCGAGTACATAAGATTCCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170786
VALIDATED
CNTF MISSION shRNA Lentiviral Transduction Particles
ciliary neurotrophic factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-597s21c1
Sequence:CCGGCCTACCAGCTAGAGGAGTTAACTCGAGTTAACTCCTCTAGCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-554s21c1
Sequence:CCGGCATCAGGCAATACATACTCTTCTCGAGAAGAGTATGTATTGCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-386s21c1
Sequence:CCGGCTTGACTCAGTGGATGGTGTACTCGAGTACACCATCCACTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170786.2-335s21c1
Sequence:CCGGGCTCTTATGGAATCTTATGTACTCGAGTACATAAGATTCCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-386s1c1
Sequence:CCGGCTTGACTCAGTGGATGGTGTACTCGAGTACACCATCCACTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-597s1c1
Sequence:CCGGCCTACCAGCTAGAGGAGTTAACTCGAGTTAACTCCTCTAGCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-769s1c1
Sequence:CCGGTGTCATTTCTTCTCATCACATCTCGAGATGTGATGAGAAGAAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-554s1c1
Sequence:CCGGCATCAGGCAATACATACTCTTCTCGAGAAGAGTATGTATTGCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170786.1-335s1c1
Sequence:CCGGGCTCTTATGGAATCTTATGTACTCGAGTACATAAGATTCCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks