EMAIL THIS PAGE TO A FRIEND

CNTFR

ciliary neurotrophic factor receptor

115 Gene Product Result for
UniProtKB ID: P26992, Q5U050
Gene ID:
Human(1271) Summary: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2011]
Mouse(12804) ciliary neurotrophic factor receptor
Rat(313173) ciliary neurotrophic factor receptor
sheep(100294658) ciliary neurotrophic factor receptor
naked mole-rat(101704145) ciliary neurotrophic factor receptor
domestic guinea pig(100722634) ciliary neurotrophic factor receptor
Zebrafish(368438) ciliary neurotrophic factor receptor
dog(442941) ciliary neurotrophic factor receptor
cow(539548) ciliary neurotrophic factor receptor
Horse(100146590) ciliary neurotrophic factor receptor
domestic cat(101083719) ciliary neurotrophic factor receptor
chicken(395885) ciliary neurotrophic factor receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001842 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078561 MISSION® esiRNA esiRNA human CNTFR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001842 Rosetta Predictions human pricing
NM_147164 Rosetta Predictions human pricing
NM_001003929 Rosetta Predictions rat pricing
NM_016673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038453 predicted 772
2 SASI_Hs01_00038454 predicted 744
3 SASI_Hs01_00038455 predicted 751
4 SASI_Hs01_00038456 predicted 647
5 SASI_Hs01_00038457 predicted 677
6 SASI_Hs01_00038458 predicted 737
7 SASI_Hs01_00038459 predicted 729
8 SASI_Hs01_00038460 predicted 412
9 SASI_Hs01_00038462 predicted 745
10 SASI_Hs02_00332651 predicted 704
11 SASI_Hs01_00038461 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027386 predicted 879
2 SASI_Hs01_00027387 predicted 855
3 SASI_Hs01_00027388 predicted 855
4 SASI_Hs01_00027389 predicted 751
5 SASI_Hs01_00027390 predicted 783
6 SASI_Hs02_00365495 predicted 847
7 SASI_Hs01_00027392 predicted 834
8 SASI_Hs01_00027394 predicted 527
9 SASI_Hs02_00365496 predicted 858
10 SASI_Hs02_00365497 predicted 1765
11 SASI_Hs01_00027391 predicted 621
12 SASI_Hs01_00027393 predicted 1791
13 SASI_Hs01_00027395 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198069 predicted 873
2 SASI_Rn01_00053914 predicted 648
3 SASI_Rn01_00053915 predicted 293
4 SASI_Rn01_00053916 predicted 235
5 SASI_Rn01_00053917 predicted 943
6 SASI_Rn01_00053918 predicted 782
7 SASI_Rn01_00053919 predicted 370
8 SASI_Rn01_00053920 predicted 656
9 SASI_Rn01_00053921 predicted 636
10 SASI_Rn01_00053922 predicted 781
11 SASI_Rn01_00053923 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023911 predicted 209
2 SASI_Mm01_00023912 predicted 843
3 SASI_Mm01_00023913 predicted 443
4 SASI_Mm01_00023914 predicted 212
5 SASI_Mm01_00023915 predicted 315
6 SASI_Mm01_00023916 predicted 254
7 SASI_Mm01_00023917 predicted 1065
8 SASI_Mm01_00023918 predicted 731
9 SASI_Mm02_00323305 predicted 1059
10 SASI_Mm02_00323306 predicted 887
11 SASI_Mm01_00023909 predicted 378
12 SASI_Mm01_00023910 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016673
VALIDATED
CNTFR MISSION shRNA Bacterial Glycerol Stock
ciliary neurotrophic factor receptor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-1384s1c1
Sequence:CCGGCATTCTCTTCAGACACAATTTCTCGAGAAATTGTGTCTGAAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016673.1-1071s1c1
Sequence:CCGGCCTCGGCATCTCACAACAGAACTCGAGTTCTGTTGTGAGATGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-372s1c1
Sequence:CCGGCAGCTGATACTGCGAAGCTTACTCGAGTAAGCTTCGCAGTATCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-207s1c1
Sequence:CCGGGCCGCTGTCTACACGCAGAAACTCGAGTTTCTGCGTGTAGACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016673.1-665s1c1
Sequence:CCGGCCTGTTCTCAACCATCAAGTACTCGAGTACTTGATGGTTGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-454s21c1
Sequence:CCGGAGTGGCCTATACGCCTGTTTCCTCGAGGAAACAGGCGTATAGGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-773s21c1
Sequence:CCGGACACTACGGCCATCACCTTTGCTCGAGCAAAGGTGATGGCCGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-364s21c1
Sequence:CCGGGCTGTGACATGGAGGGTAAACCTCGAGGTTTACCCTCCATGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016673
VALIDATED
CNTFR MISSION shRNA shRNA Plasmid DNA
ciliary neurotrophic factor receptor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-1384s1c1
Sequence:CCGGCATTCTCTTCAGACACAATTTCTCGAGAAATTGTGTCTGAAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016673.1-1071s1c1
Sequence:CCGGCCTCGGCATCTCACAACAGAACTCGAGTTCTGTTGTGAGATGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-372s1c1
Sequence:CCGGCAGCTGATACTGCGAAGCTTACTCGAGTAAGCTTCGCAGTATCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-207s1c1
Sequence:CCGGGCCGCTGTCTACACGCAGAAACTCGAGTTTCTGCGTGTAGACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016673.1-665s1c1
Sequence:CCGGCCTGTTCTCAACCATCAAGTACTCGAGTACTTGATGGTTGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-454s21c1
Sequence:CCGGAGTGGCCTATACGCCTGTTTCCTCGAGGAAACAGGCGTATAGGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-773s21c1
Sequence:CCGGACACTACGGCCATCACCTTTGCTCGAGCAAAGGTGATGGCCGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-364s21c1
Sequence:CCGGGCTGTGACATGGAGGGTAAACCTCGAGGTTTACCCTCCATGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016673
VALIDATED
CNTFR MISSION shRNA Lentiviral Transduction Particles
ciliary neurotrophic factor receptor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-1384s1c1
Sequence:CCGGCATTCTCTTCAGACACAATTTCTCGAGAAATTGTGTCTGAAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016673.1-1071s1c1
Sequence:CCGGCCTCGGCATCTCACAACAGAACTCGAGTTCTGTTGTGAGATGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-372s1c1
Sequence:CCGGCAGCTGATACTGCGAAGCTTACTCGAGTAAGCTTCGCAGTATCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016673.1-207s1c1
Sequence:CCGGGCCGCTGTCTACACGCAGAAACTCGAGTTTCTGCGTGTAGACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016673.1-665s1c1
Sequence:CCGGCCTGTTCTCAACCATCAAGTACTCGAGTACTTGATGGTTGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-454s21c1
Sequence:CCGGAGTGGCCTATACGCCTGTTTCCTCGAGGAAACAGGCGTATAGGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-773s21c1
Sequence:CCGGACACTACGGCCATCACCTTTGCTCGAGCAAAGGTGATGGCCGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016673.2-364s21c1
Sequence:CCGGGCTGTGACATGGAGGGTAAACCTCGAGGTTTACCCTCCATGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001842
CNTFR MISSION shRNA Bacterial Glycerol Stock
ciliary neurotrophic factor receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001842.3-1397s1c1
Sequence:CCGGGCATTCTCTTCAGACACAATTCTCGAGAATTGTGTCTGAAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-887s1c1
Sequence:CCGGTCTCAAGTTCTTTCTGCGCTACTCGAGTAGCGCAGAAAGAACTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-692s1c1
Sequence:CCGGCATCAAGTACAAGGTCTCCATCTCGAGATGGAGACCTTGTACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-1011s1c1
Sequence:CCGGGCAGCCAAGGACAATGAGATTCTCGAGAATCTCATTGTCCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-665s1c1
Sequence:CCGGCATTCGCTACATGCACCTGTTCTCGAGAACAGGTGCATGTAGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-577s21c1
Sequence:CCGGACATTCCCAACACCTTCAATGCTCGAGCATTGAAGGTGTTGGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-739s21c1
Sequence:CCGGATGCCACAGCTATCACCTTTGCTCGAGCAAAGGTGATAGCTGTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-984s21c1
Sequence:CCGGGCCGGGAAGGAGTACATTATCCTCGAGGATAATGTACTCCTTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001842.3-1605s21c1
Sequence:CCGGGAGCCTCTCACATCCGATTTCCTCGAGGAAATCGGATGTGAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001842
CNTFR MISSION shRNA shRNA Plasmid DNA
ciliary neurotrophic factor receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001842.3-1397s1c1
Sequence:CCGGGCATTCTCTTCAGACACAATTCTCGAGAATTGTGTCTGAAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-887s1c1
Sequence:CCGGTCTCAAGTTCTTTCTGCGCTACTCGAGTAGCGCAGAAAGAACTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-692s1c1
Sequence:CCGGCATCAAGTACAAGGTCTCCATCTCGAGATGGAGACCTTGTACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-1011s1c1
Sequence:CCGGGCAGCCAAGGACAATGAGATTCTCGAGAATCTCATTGTCCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-665s1c1
Sequence:CCGGCATTCGCTACATGCACCTGTTCTCGAGAACAGGTGCATGTAGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-577s21c1
Sequence:CCGGACATTCCCAACACCTTCAATGCTCGAGCATTGAAGGTGTTGGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-739s21c1
Sequence:CCGGATGCCACAGCTATCACCTTTGCTCGAGCAAAGGTGATAGCTGTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-984s21c1
Sequence:CCGGGCCGGGAAGGAGTACATTATCCTCGAGGATAATGTACTCCTTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001842.3-1605s21c1
Sequence:CCGGGAGCCTCTCACATCCGATTTCCTCGAGGAAATCGGATGTGAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001842
CNTFR MISSION shRNA Lentiviral Transduction Particles
ciliary neurotrophic factor receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001842.3-1397s1c1
Sequence:CCGGGCATTCTCTTCAGACACAATTCTCGAGAATTGTGTCTGAAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-887s1c1
Sequence:CCGGTCTCAAGTTCTTTCTGCGCTACTCGAGTAGCGCAGAAAGAACTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-692s1c1
Sequence:CCGGCATCAAGTACAAGGTCTCCATCTCGAGATGGAGACCTTGTACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-1011s1c1
Sequence:CCGGGCAGCCAAGGACAATGAGATTCTCGAGAATCTCATTGTCCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001842.3-665s1c1
Sequence:CCGGCATTCGCTACATGCACCTGTTCTCGAGAACAGGTGCATGTAGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-577s21c1
Sequence:CCGGACATTCCCAACACCTTCAATGCTCGAGCATTGAAGGTGTTGGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-739s21c1
Sequence:CCGGATGCCACAGCTATCACCTTTGCTCGAGCAAAGGTGATAGCTGTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001842.3-984s21c1
Sequence:CCGGGCCGGGAAGGAGTACATTATCCTCGAGGATAATGTACTCCTTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001842.3-1605s21c1
Sequence:CCGGGAGCCTCTCACATCCGATTTCCTCGAGGAAATCGGATGTGAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks