EMAIL THIS PAGE TO A FRIEND

CNTLN

centlein, centrosomal protein

112 Gene Product Result for
Synonyms: C9orf101 C9orf39 RP11-340N12.1 bA340N12.1
UniProtKB ID: Q9NXG0, A5Z2X6, Q5VYJ0, Q8N1G9, Q9HAJ5
Gene ID:
Mouse(338349) centlein, centrosomal protein
Rat(679640) centlein, centrosomal protein
domestic cat(101097184) centlein, centrosomal protein
Horse(100052128) centlein, centrosomal protein
cow(532280) centlein, centrosomal protein
dog(481548) centlein, centrosomal protein
domestic guinea pig(100716376) centlein, centrosomal protein
naked mole-rat(101725728) centlein, centrosomal protein
sheep(101122503) centlein, centrosomal protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114395 Rosetta Predictions human pricing
NM_017738 Rosetta Predictions human pricing
NM_001114402 Rosetta Predictions rat pricing
NM_175275 Rosetta Predictions mouse pricing
NM_177385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326594 predicted 919
2 SASI_Hs02_00326595 predicted 393
3 SASI_Hs02_00326596 predicted 423
4 SASI_Hs02_00326597 predicted 694
5 SASI_Hs02_00326598 predicted 910
6 SASI_Hs02_00326599 predicted 449
7 SASI_Hs02_00326600 predicted 934
8 SASI_Hs02_00326601 predicted 907
9 SASI_Hs02_00326602 predicted 895
10 SASI_Hs02_00326603 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350529 predicted 917
2 SASI_Hs02_00350530 predicted 395
3 SASI_Hs02_00350531 predicted 428
4 SASI_Hs02_00350532 predicted 695
5 SASI_Hs02_00350533 predicted 914
6 SASI_Hs02_00350534 predicted 451
7 SASI_Hs02_00350535 predicted 937
8 SASI_Hs02_00350536 predicted 908
9 SASI_Hs02_00350537 predicted 898
10 SASI_Hs02_00350538 predicted 938
11 SASI_Hs01_00037189 predicted 793
12 SASI_Hs01_00037190 predicted 2621
13 SASI_Hs01_00037191 predicted 2477
14 SASI_Hs01_00037192 predicted 542
15 SASI_Hs01_00037193 predicted 2386
16 SASI_Hs01_00037194 predicted 367
17 SASI_Hs01_00037195 predicted 1618
18 SASI_Hs01_00037196 predicted 2726
19 SASI_Hs01_00037197 predicted 2495
20 SASI_Hs01_00037198 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252253 predicted 646
2 SASI_Rn02_00252254 predicted 1137
3 SASI_Rn02_00252255 predicted 1813
4 SASI_Rn02_00252256 predicted 1614
5 SASI_Rn02_00252257 predicted 502
6 SASI_Rn02_00252258 predicted 1197
7 SASI_Rn02_00252259 predicted 1350
8 SASI_Rn02_00252260 predicted 1969
9 SASI_Rn02_00252261 predicted 1562
10 SASI_Rn02_00252262 predicted 2217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068174 predicted 495
2 SASI_Mm01_00068175 predicted 535
3 SASI_Mm02_00346000 predicted 739
4 SASI_Mm01_00068176 predicted 569
5 SASI_Mm01_00068177 predicted 503
6 SASI_Mm01_00068178 predicted 551
7 SASI_Mm01_00068179 predicted 563
8 SASI_Mm02_00346001 predicted 563
9 SASI_Mm01_00068180 predicted 436
10 SASI_Mm01_00068181 predicted 541
11 SASI_Mm01_00068173 predicted 768
12 SASI_Mm01_00068182 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083557 predicted 502
2 SASI_Mm01_00083558 predicted 537
3 SASI_Mm02_00347562 predicted 742
4 SASI_Mm01_00083559 predicted 568
5 SASI_Mm01_00083560 predicted 499
6 SASI_Mm01_00083561 predicted 552
7 SASI_Mm01_00083562 predicted 556
8 SASI_Mm02_00347563 predicted 570
9 SASI_Mm01_00083563 predicted 438
10 SASI_Mm01_00083564 predicted 539
11 SASI_Mm01_00083556 predicted 763
12 SASI_Mm01_00083565 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017738
CNTLN MISSION shRNA Bacterial Glycerol Stock
centlein, centrosomal protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017738.2-1859s21c1
Sequence:CCGGGTGGAATGAACTGGCATATTTCTCGAGAAATATGCCAGTTCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017738.2-2974s21c1
Sequence:CCGGTATTACGAGAACGGATTATATCTCGAGATATAATCCGTTCTCGTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-2909s1c1
Sequence:CCGGGCAGCATCTAAGCAGCTTCAACTCGAGTTGAAGCTGCTTAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017738.1-4017s1c1
Sequence:CCGGGCTCTCATTGATGTGCTGGTTCTCGAGAACCAGCACATCAATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017738.1-4259s1c1
Sequence:CCGGCCTGAACATTCCCACCTCATTCTCGAGAATGAGGTGGGAATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017738.1-3794s1c1
Sequence:CCGGGCAGGCTTGGTACACACAAATCTCGAGATTTGTGTGTACCAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-3067s1c1
Sequence:CCGGGCGACAAATAAGAGAGCTTAACTCGAGTTAAGCTCTCTTATTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-2402s1c1
Sequence:CCGGCGGATACAAGTTACATCACTTCTCGAGAAGTGATGTAACTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017738.1-3598s1c1
Sequence:CCGGCCAACTATCAATAGTCAGGTTCTCGAGAACCTGACTATTGATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017738.1-2399s1c1
Sequence:CCGGCCACGGATACAAGTTACATCACTCGAGTGATGTAACTTGTATCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017738
CNTLN MISSION shRNA shRNA Plasmid DNA
centlein, centrosomal protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017738.2-1859s21c1
Sequence:CCGGGTGGAATGAACTGGCATATTTCTCGAGAAATATGCCAGTTCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017738.2-2974s21c1
Sequence:CCGGTATTACGAGAACGGATTATATCTCGAGATATAATCCGTTCTCGTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-2909s1c1
Sequence:CCGGGCAGCATCTAAGCAGCTTCAACTCGAGTTGAAGCTGCTTAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017738.1-4017s1c1
Sequence:CCGGGCTCTCATTGATGTGCTGGTTCTCGAGAACCAGCACATCAATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017738.1-4259s1c1
Sequence:CCGGCCTGAACATTCCCACCTCATTCTCGAGAATGAGGTGGGAATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017738.1-3794s1c1
Sequence:CCGGGCAGGCTTGGTACACACAAATCTCGAGATTTGTGTGTACCAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-3067s1c1
Sequence:CCGGGCGACAAATAAGAGAGCTTAACTCGAGTTAAGCTCTCTTATTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-2402s1c1
Sequence:CCGGCGGATACAAGTTACATCACTTCTCGAGAAGTGATGTAACTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017738.1-3598s1c1
Sequence:CCGGCCAACTATCAATAGTCAGGTTCTCGAGAACCTGACTATTGATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017738.1-2399s1c1
Sequence:CCGGCCACGGATACAAGTTACATCACTCGAGTGATGTAACTTGTATCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017738
CNTLN MISSION shRNA Lentiviral Transduction Particles
centlein, centrosomal protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017738.2-1859s21c1
Sequence:CCGGGTGGAATGAACTGGCATATTTCTCGAGAAATATGCCAGTTCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017738.2-2974s21c1
Sequence:CCGGTATTACGAGAACGGATTATATCTCGAGATATAATCCGTTCTCGTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-2909s1c1
Sequence:CCGGGCAGCATCTAAGCAGCTTCAACTCGAGTTGAAGCTGCTTAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017738.1-4017s1c1
Sequence:CCGGGCTCTCATTGATGTGCTGGTTCTCGAGAACCAGCACATCAATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017738.1-4259s1c1
Sequence:CCGGCCTGAACATTCCCACCTCATTCTCGAGAATGAGGTGGGAATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017738.1-3794s1c1
Sequence:CCGGGCAGGCTTGGTACACACAAATCTCGAGATTTGTGTGTACCAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-3067s1c1
Sequence:CCGGGCGACAAATAAGAGAGCTTAACTCGAGTTAAGCTCTCTTATTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017738.1-2402s1c1
Sequence:CCGGCGGATACAAGTTACATCACTTCTCGAGAAGTGATGTAACTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017738.1-3598s1c1
Sequence:CCGGCCAACTATCAATAGTCAGGTTCTCGAGAACCTGACTATTGATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017738.1-2399s1c1
Sequence:CCGGCCACGGATACAAGTTACATCACTCGAGTGATGTAACTTGTATCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177385
CNTLN MISSION shRNA Bacterial Glycerol Stock
centlein, centrosomal protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-1030s21c1
Sequence:CCGGTTCTTACAGCAGCCGAATATACTCGAGTATATTCGGCTGCTGTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-529s21c1
Sequence:CCGGAGGCGTCTTCAGGCAACAAACCTCGAGGTTTGTTGCCTGAAGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-1092s21c1
Sequence:CCGGGTAGGGACCAGCATTAATTTACTCGAGTAAATTAATGCTGGTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-966s21c1
Sequence:CCGGCAGTGTGGACACGAGAGTAAACTCGAGTTTACTCTCGTGTCCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177385.3-1698s21c1
Sequence:CCGGTGTATCTCTTGTATGAGTATTCTCGAGAATACTCATACAAGAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177385.2-831s1c1
Sequence:CCGGCTGCTAAATGACCTGGAGAAACTCGAGTTTCTCCAGGTCATTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177385.2-1314s1c1
Sequence:CCGGGCATGGTTCTATGATAATGTTCTCGAGAACATTATCATAGAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177385.2-960s1c1
Sequence:CCGGCAGCAGCCGAATATAAGATTTCTCGAGAAATCTTATATTCGGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177385
CNTLN MISSION shRNA shRNA Plasmid DNA
centlein, centrosomal protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-1030s21c1
Sequence:CCGGTTCTTACAGCAGCCGAATATACTCGAGTATATTCGGCTGCTGTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-529s21c1
Sequence:CCGGAGGCGTCTTCAGGCAACAAACCTCGAGGTTTGTTGCCTGAAGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-1092s21c1
Sequence:CCGGGTAGGGACCAGCATTAATTTACTCGAGTAAATTAATGCTGGTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-966s21c1
Sequence:CCGGCAGTGTGGACACGAGAGTAAACTCGAGTTTACTCTCGTGTCCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177385.3-1698s21c1
Sequence:CCGGTGTATCTCTTGTATGAGTATTCTCGAGAATACTCATACAAGAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177385.2-831s1c1
Sequence:CCGGCTGCTAAATGACCTGGAGAAACTCGAGTTTCTCCAGGTCATTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177385.2-1314s1c1
Sequence:CCGGGCATGGTTCTATGATAATGTTCTCGAGAACATTATCATAGAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177385.2-960s1c1
Sequence:CCGGCAGCAGCCGAATATAAGATTTCTCGAGAAATCTTATATTCGGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177385
CNTLN MISSION shRNA Lentiviral Transduction Particles
centlein, centrosomal protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-1030s21c1
Sequence:CCGGTTCTTACAGCAGCCGAATATACTCGAGTATATTCGGCTGCTGTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-529s21c1
Sequence:CCGGAGGCGTCTTCAGGCAACAAACCTCGAGGTTTGTTGCCTGAAGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-1092s21c1
Sequence:CCGGGTAGGGACCAGCATTAATTTACTCGAGTAAATTAATGCTGGTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177385.3-966s21c1
Sequence:CCGGCAGTGTGGACACGAGAGTAAACTCGAGTTTACTCTCGTGTCCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177385.3-1698s21c1
Sequence:CCGGTGTATCTCTTGTATGAGTATTCTCGAGAATACTCATACAAGAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177385.2-831s1c1
Sequence:CCGGCTGCTAAATGACCTGGAGAAACTCGAGTTTCTCCAGGTCATTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177385.2-1314s1c1
Sequence:CCGGGCATGGTTCTATGATAATGTTCTCGAGAACATTATCATAGAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177385.2-960s1c1
Sequence:CCGGCAGCAGCCGAATATAAGATTTCTCGAGAAATCTTATATTCGGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks