EMAIL THIS PAGE TO A FRIEND

CNTN1

contactin 1

Synonyms: F3 GP135
Gene ID:
Human(1272) Summary: The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(12805) contactin 1
Rat(117258) contactin 1
sheep(101118005) contactin 1
chicken(417786) contactin 1
cow(281705) contactin 1
Horse(100049925) contactin 1
dog(477641) contactin 1
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001843 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073341 MISSION® esiRNA esiRNA human CNTN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001843 Rosetta Predictions human pricing
NM_175038 Rosetta Predictions human pricing
NM_057118 Rosetta Predictions rat pricing
NM_007727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332652 predicted 2306
2 SASI_Hs01_00113397 predicted 1614
3 SASI_Hs01_00113399 predicted 1488
4 SASI_Hs01_00113401 predicted 790
5 SASI_Hs02_00332653 predicted 2343
6 SASI_Hs01_00113402 predicted 2487
7 SASI_Hs01_00113403 predicted 2979
8 SASI_Hs01_00113404 predicted 2922
9 SASI_Hs02_00332654 predicted 1510
10 SASI_Hs01_00113405 predicted 2494
11 SASI_Hs01_00113398 predicted 2028
12 SASI_Hs01_00113400 predicted 2789
13 SASI_Hs01_00113406 predicted 2838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080897 predicted 1575
2 SASI_Hs02_00368932 predicted 1992
3 SASI_Hs01_00080898 predicted 1447
4 SASI_Hs01_00080900 predicted 760
5 SASI_Hs01_00080902 predicted 2309
6 SASI_Hs01_00080904 predicted 2458
7 SASI_Hs01_00080905 predicted 2949
8 SASI_Hs01_00080906 predicted 2888
9 SASI_Hs02_00368933 predicted 1475
10 SASI_Hs02_00368934 predicted 2458
11 SASI_Hs01_00080899 predicted 2763
12 SASI_Hs01_00080901 predicted 2976
13 SASI_Hs01_00080903 predicted 2303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090001 predicted 2327
2 SASI_Rn01_00090002 predicted 1509
3 SASI_Rn01_00090003 predicted 1774
4 SASI_Rn02_00267053 predicted 2025
5 SASI_Rn01_00090004 predicted 726
6 SASI_Rn01_00090005 predicted 2763
7 SASI_Rn01_00090006 predicted 710
8 SASI_Rn01_00090007 predicted 2162
9 SASI_Rn01_00090009 predicted 1288
10 SASI_Rn01_00090010 predicted 1392
11 SASI_Rn01_00090008 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094383 predicted 286
2 SASI_Mm01_00094384 predicted 3161
3 SASI_Mm01_00094385 predicted 1617
4 SASI_Mm01_00094386 predicted 1216
5 SASI_Mm01_00094387 predicted 3116
6 SASI_Mm01_00094388 predicted 1017
7 SASI_Mm01_00094389 predicted 821
8 SASI_Mm01_00094390 predicted 3036
9 SASI_Mm01_00094391 predicted 1674
10 SASI_Mm02_00312318 predicted 1401
11 SASI_Mm01_00094382 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007727
CNTN1 MISSION shRNA Bacterial Glycerol Stock
contactin 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007727.1-3408s1c1
Sequence:CCGGGCCAAACAAATTAGACTCTAACTCGAGTTAGAGTCTAATTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-2611s1c1
Sequence:CCGGGCCTTCAACAATAAAGGAGATCTCGAGATCTCCTTTATTGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-828s1c1
Sequence:CCGGCGGCAATCTCTACATCGCAAACTCGAGTTTGCGATGTAGAGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-1473s1c1
Sequence:CCGGCCTGGCTTTAGCTCCAACTTTCTCGAGAAAGTTGGAGCTAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-384s1c1
Sequence:CCGGGCAGCCAATCAATACCATTTACTCGAGTAAATGGTATTGATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007727.2-1783s21c1
Sequence:CCGGACAAATCCCACACGAATTATTCTCGAGAATAATTCGTGTGGGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007727.2-823s21c1
Sequence:CCGGACCATGGATAAGCGAAGATTTCTCGAGAAATCTTCGCTTATCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007727
CNTN1 MISSION shRNA shRNA Plasmid DNA
contactin 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007727.1-3408s1c1
Sequence:CCGGGCCAAACAAATTAGACTCTAACTCGAGTTAGAGTCTAATTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-2611s1c1
Sequence:CCGGGCCTTCAACAATAAAGGAGATCTCGAGATCTCCTTTATTGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-828s1c1
Sequence:CCGGCGGCAATCTCTACATCGCAAACTCGAGTTTGCGATGTAGAGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-1473s1c1
Sequence:CCGGCCTGGCTTTAGCTCCAACTTTCTCGAGAAAGTTGGAGCTAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-384s1c1
Sequence:CCGGGCAGCCAATCAATACCATTTACTCGAGTAAATGGTATTGATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007727.2-1783s21c1
Sequence:CCGGACAAATCCCACACGAATTATTCTCGAGAATAATTCGTGTGGGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007727.2-823s21c1
Sequence:CCGGACCATGGATAAGCGAAGATTTCTCGAGAAATCTTCGCTTATCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007727
CNTN1 MISSION shRNA Lentiviral Transduction Particles
contactin 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007727.1-3408s1c1
Sequence:CCGGGCCAAACAAATTAGACTCTAACTCGAGTTAGAGTCTAATTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-2611s1c1
Sequence:CCGGGCCTTCAACAATAAAGGAGATCTCGAGATCTCCTTTATTGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-828s1c1
Sequence:CCGGCGGCAATCTCTACATCGCAAACTCGAGTTTGCGATGTAGAGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-1473s1c1
Sequence:CCGGCCTGGCTTTAGCTCCAACTTTCTCGAGAAAGTTGGAGCTAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007727.1-384s1c1
Sequence:CCGGGCAGCCAATCAATACCATTTACTCGAGTAAATGGTATTGATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007727.2-1783s21c1
Sequence:CCGGACAAATCCCACACGAATTATTCTCGAGAATAATTCGTGTGGGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007727.2-823s21c1
Sequence:CCGGACCATGGATAAGCGAAGATTTCTCGAGAAATCTTCGCTTATCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001843
VALIDATED
CNTN1 MISSION shRNA Bacterial Glycerol Stock
contactin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001843.2-3257s1c1
Sequence:CCGGGCTCCATCCTAAGCCAAATAACTCGAGTTATTTGGCTTAGGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-329s1c1
Sequence:CCGGCCCGGTTTACAAATGGAGAATCTCGAGATTCTCCATTTGTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-2838s1c1
Sequence:CCGGCCAAGGATCATCAGTTCAGTACTCGAGTACTGAACTGATGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-1269s1c1
Sequence:CCGGGCCGGAATGTATCAGTGCATACTCGAGTATGCACTGATACATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-1987s21c1
Sequence:CCGGGCCGTGGTTCAGACAATCATACTCGAGTATGATTGTCTGAACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-1987s1c2
Sequence:CCGGGCCGTGGTTCAGACAATCATACTCGAGTATGATTGTCTGAACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-329s21c1
Sequence:CCGGCCCGGTTTACAAATGGAGAATCTCGAGATTCTCCATTTGTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-1269s21c1
Sequence:CCGGGCCGGAATGTATCAGTGCATACTCGAGTATGCACTGATACATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001843.2-2838s21c1
Sequence:CCGGCCAAGGATCATCAGTTCAGTACTCGAGTACTGAACTGATGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001843
VALIDATED
CNTN1 MISSION shRNA shRNA Plasmid DNA
contactin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001843.2-3257s1c1
Sequence:CCGGGCTCCATCCTAAGCCAAATAACTCGAGTTATTTGGCTTAGGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-329s1c1
Sequence:CCGGCCCGGTTTACAAATGGAGAATCTCGAGATTCTCCATTTGTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-2838s1c1
Sequence:CCGGCCAAGGATCATCAGTTCAGTACTCGAGTACTGAACTGATGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-1269s1c1
Sequence:CCGGGCCGGAATGTATCAGTGCATACTCGAGTATGCACTGATACATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-1987s21c1
Sequence:CCGGGCCGTGGTTCAGACAATCATACTCGAGTATGATTGTCTGAACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-1987s1c2
Sequence:CCGGGCCGTGGTTCAGACAATCATACTCGAGTATGATTGTCTGAACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-329s21c1
Sequence:CCGGCCCGGTTTACAAATGGAGAATCTCGAGATTCTCCATTTGTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-1269s21c1
Sequence:CCGGGCCGGAATGTATCAGTGCATACTCGAGTATGCACTGATACATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001843.2-2838s21c1
Sequence:CCGGCCAAGGATCATCAGTTCAGTACTCGAGTACTGAACTGATGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001843
VALIDATED
CNTN1 MISSION shRNA Lentiviral Transduction Particles
contactin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001843.2-3257s1c1
Sequence:CCGGGCTCCATCCTAAGCCAAATAACTCGAGTTATTTGGCTTAGGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-329s1c1
Sequence:CCGGCCCGGTTTACAAATGGAGAATCTCGAGATTCTCCATTTGTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-2838s1c1
Sequence:CCGGCCAAGGATCATCAGTTCAGTACTCGAGTACTGAACTGATGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-1269s1c1
Sequence:CCGGGCCGGAATGTATCAGTGCATACTCGAGTATGCACTGATACATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-1987s21c1
Sequence:CCGGGCCGTGGTTCAGACAATCATACTCGAGTATGATTGTCTGAACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001843.2-1987s1c2
Sequence:CCGGGCCGTGGTTCAGACAATCATACTCGAGTATGATTGTCTGAACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-329s21c1
Sequence:CCGGCCCGGTTTACAAATGGAGAATCTCGAGATTCTCCATTTGTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001843.2-1269s21c1
Sequence:CCGGGCCGGAATGTATCAGTGCATACTCGAGTATGCACTGATACATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001843.2-2838s21c1
Sequence:CCGGCCAAGGATCATCAGTTCAGTACTCGAGTACTGAACTGATGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks