EMAIL THIS PAGE TO A FRIEND

CNTN2

contactin 2 (axonal)

84 Gene Product Result for
Synonyms: AXT FAME5 TAG-1 TAX TAX1
UniProtKB ID: Q02246, P78432, Q5T054
Gene ID:
Human(6900) Summary: The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. It may also be involved in glial tumorigenesis and may provide a potential target for therapeutic intervention. [provided by RefSeq, Jul 2008]
Mouse(21367) contactin 2
Rat(25356) contactin 2 (axonal)
Zebrafish(30726) contactin 2
chicken(419825) contactin 2 (axonal)
dog(100685268) contactin 2 (axonal)
domestic cat(101084252) contactin 2 (axonal)
cow(100140960) contactin 2 (axonal)
cow(528595) contactin 2 (axonal)
domestic guinea pig(100721266) contactin 2 (axonal)
naked mole-rat(101714593) contactin 2 (axonal)
sheep(101113348) contactin 2 (axonal)
Domestic Rabbit(100357508) contactin 2 (axonal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005076 Rosetta Predictions human pricing
NM_012884 Rosetta Predictions rat pricing
NM_177129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058941 predicted 3103
2 SASI_Hs01_00058943 predicted 3160
3 SASI_Hs01_00058944 predicted 1734
4 SASI_Hs02_00338913 predicted 972
5 SASI_Hs02_00338914 predicted 3117
6 SASI_Hs01_00058945 predicted 3012
7 SASI_Hs01_00058947 predicted 1827
8 SASI_Hs01_00058948 predicted 925
9 SASI_Hs01_00058949 predicted 2615
10 SASI_Hs01_00058950 predicted 1226
11 SASI_Hs01_00058942 predicted 1825
12 SASI_Hs01_00058946 predicted 3131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093509 predicted 669
2 SASI_Rn02_00260397 predicted 3088
3 SASI_Rn01_00093511 predicted 3062
4 SASI_Rn01_00093512 predicted 783
5 SASI_Rn01_00093513 predicted 2863
6 SASI_Rn01_00093514 predicted 2750
7 SASI_Rn01_00093515 predicted 2527
8 SASI_Rn01_00093516 predicted 1241
9 SASI_Rn01_00093517 predicted 2266
10 SASI_Rn01_00093518 predicted 2875
11 SASI_Rn01_00093510 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081867 predicted 2169
2 SASI_Mm01_00081868 predicted 1265
3 SASI_Mm01_00081869 predicted 1863
4 SASI_Mm01_00081870 predicted 2158
5 SASI_Mm01_00081871 predicted 2345
6 SASI_Mm01_00081872 predicted 3142
7 SASI_Mm01_00081873 predicted 1708
8 SASI_Mm01_00081874 predicted 2514
9 SASI_Mm01_00081875 predicted 596
10 SASI_Mm01_00081876 predicted 2484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005076
CNTN2 MISSION shRNA Bacterial Glycerol Stock
contactin 2 (axonal)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005076.2-3092s21c1
Sequence:CCGGGTCTGCAGTCACCGGCTATAACTCGAGTTATAGCCGGTGACTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005076.2-3200s21c1
Sequence:CCGGTGGCCATGCCCTGGTACAAATCTCGAGATTTGTACCAGGGCATGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005076.2-5839s1c1
Sequence:CCGGGCAGAATTTGTTTGAGGGATACTCGAGTATCCCTCAAACAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-3161s1c1
Sequence:CCGGCGGCAAGAACTGGATAGAAATCTCGAGATTTCTATCCAGTTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-2777s1c1
Sequence:CCGGGCAGCAGGACATGAATGGTATCTCGAGATACCATTCATGTCCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-1706s1c1
Sequence:CCGGCCGGTCAGATGAAGGCAAATACTCGAGTATTTGCCTTCATCTGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-1737s1c1
Sequence:CCGGGCTGAGAACTTCATGGGCAAACTCGAGTTTGCCCATGAAGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005076
CNTN2 MISSION shRNA shRNA Plasmid DNA
contactin 2 (axonal)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005076.2-3092s21c1
Sequence:CCGGGTCTGCAGTCACCGGCTATAACTCGAGTTATAGCCGGTGACTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005076.2-3200s21c1
Sequence:CCGGTGGCCATGCCCTGGTACAAATCTCGAGATTTGTACCAGGGCATGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005076.2-5839s1c1
Sequence:CCGGGCAGAATTTGTTTGAGGGATACTCGAGTATCCCTCAAACAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-3161s1c1
Sequence:CCGGCGGCAAGAACTGGATAGAAATCTCGAGATTTCTATCCAGTTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-2777s1c1
Sequence:CCGGGCAGCAGGACATGAATGGTATCTCGAGATACCATTCATGTCCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-1706s1c1
Sequence:CCGGCCGGTCAGATGAAGGCAAATACTCGAGTATTTGCCTTCATCTGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-1737s1c1
Sequence:CCGGGCTGAGAACTTCATGGGCAAACTCGAGTTTGCCCATGAAGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005076
CNTN2 MISSION shRNA Lentiviral Transduction Particles
contactin 2 (axonal)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005076.2-3092s21c1
Sequence:CCGGGTCTGCAGTCACCGGCTATAACTCGAGTTATAGCCGGTGACTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005076.2-3200s21c1
Sequence:CCGGTGGCCATGCCCTGGTACAAATCTCGAGATTTGTACCAGGGCATGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005076.2-5839s1c1
Sequence:CCGGGCAGAATTTGTTTGAGGGATACTCGAGTATCCCTCAAACAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-3161s1c1
Sequence:CCGGCGGCAAGAACTGGATAGAAATCTCGAGATTTCTATCCAGTTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-2777s1c1
Sequence:CCGGGCAGCAGGACATGAATGGTATCTCGAGATACCATTCATGTCCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-1706s1c1
Sequence:CCGGCCGGTCAGATGAAGGCAAATACTCGAGTATTTGCCTTCATCTGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005076.2-1737s1c1
Sequence:CCGGGCTGAGAACTTCATGGGCAAACTCGAGTTTGCCCATGAAGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177129
CNTN2 MISSION shRNA Bacterial Glycerol Stock
contactin 2 (axonal)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000238744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-1714s21c1
Sequence:CCGGTTGGACGGCACCTTGATTATCCTCGAGGATAATCAAGGTGCCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-3377s21c1
Sequence:CCGGTGTTCTCCTGCATGGTTATACCTCGAGGTATAACCATGCAGGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-2407s21c1
Sequence:CCGGTCCAGCAGAATCCGCACTAAGCTCGAGCTTAGTGCGGATTCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177129.5-3568s21c1
Sequence:CCGGTACGTAGGAGGTAGGATATTTCTCGAGAAATATCCTACCTCCTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177129
CNTN2 MISSION shRNA shRNA Plasmid DNA
contactin 2 (axonal)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000238744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-1714s21c1
Sequence:CCGGTTGGACGGCACCTTGATTATCCTCGAGGATAATCAAGGTGCCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-3377s21c1
Sequence:CCGGTGTTCTCCTGCATGGTTATACCTCGAGGTATAACCATGCAGGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-2407s21c1
Sequence:CCGGTCCAGCAGAATCCGCACTAAGCTCGAGCTTAGTGCGGATTCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177129.5-3568s21c1
Sequence:CCGGTACGTAGGAGGTAGGATATTTCTCGAGAAATATCCTACCTCCTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177129
CNTN2 MISSION shRNA Lentiviral Transduction Particles
contactin 2 (axonal)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000238744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-1714s21c1
Sequence:CCGGTTGGACGGCACCTTGATTATCCTCGAGGATAATCAAGGTGCCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-3377s21c1
Sequence:CCGGTGTTCTCCTGCATGGTTATACCTCGAGGTATAACCATGCAGGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177129.5-2407s21c1
Sequence:CCGGTCCAGCAGAATCCGCACTAAGCTCGAGCTTAGTGCGGATTCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177129.5-3568s21c1
Sequence:CCGGTACGTAGGAGGTAGGATATTTCTCGAGAAATATCCTACCTCCTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks