EMAIL THIS PAGE TO A FRIEND

CNTN3

contactin 3 (plasmacytoma associated)

167 Gene Product Result for
Synonyms: BIG-1 PANG PCS
UniProtKB ID: Q9P232, B9EK50, Q9H039
Gene ID:
Mouse(18488) contactin 3
Rat(54279) contactin 3 (plasmacytoma associated)
sheep(101113628) contactin 3 (plasmacytoma associated)
naked mole-rat(101697892) contactin 3 (plasmacytoma associated)
domestic guinea pig(100731213) contactin 3 (plasmacytoma associated)
chicken(416101) contactin 3 (plasmacytoma associated)
dog(476555) contactin 3 (plasmacytoma associated)
domestic cat(101094833) contactin 3 (plasmacytoma associated)
cow(526697) contactin 3 (plasmacytoma associated)
Horse(100061548) contactin 3 (plasmacytoma associated)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020872 Rosetta Predictions human pricing
NM_019329 Rosetta Predictions rat pricing
NM_008779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244604 predicted 2621
2 SASI_Hs01_00244605 predicted 2353
3 SASI_Hs01_00244608 predicted 3093
4 SASI_Hs01_00244609 predicted 283
5 SASI_Hs01_00244610 predicted 1626
6 SASI_Hs01_00244611 predicted 552
7 SASI_Hs01_00244612 predicted 1727
8 SASI_Hs01_00244613 predicted 2864
9 SASI_Hs02_00354169 predicted 1546
10 SASI_Hs02_00354170 predicted 1183
11 SASI_Hs01_00244606 predicted 539
12 SASI_Hs01_00244607 predicted 2972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097958 predicted 2027
2 SASI_Rn01_00097959 predicted 2308
3 SASI_Rn01_00097960 predicted 2321
4 SASI_Rn01_00097961 predicted 1634
5 SASI_Rn01_00097962 predicted 912
6 SASI_Rn01_00097963 predicted 2596
7 SASI_Rn01_00097964 predicted 286
8 SASI_Rn01_00097965 predicted 2830
9 SASI_Rn01_00097966 predicted 995
10 SASI_Rn02_00262298 predicted 2849
11 SASI_Rn01_00097967 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130571 predicted 275
2 SASI_Mm01_00130572 predicted 1945
3 SASI_Mm01_00130573 predicted 543
4 SASI_Mm02_00314675 predicted 595
5 SASI_Mm01_00130575 predicted 1415
6 SASI_Mm01_00130576 predicted 2865
7 SASI_Mm01_00130578 predicted 2341
8 SASI_Mm01_00130579 predicted 1035
9 SASI_Mm02_00314676 predicted 1735
10 SASI_Mm02_00314677 predicted 328
11 SASI_Mm01_00130574 predicted 840
12 SASI_Mm01_00130577 predicted 433
13 SASI_Mm01_00130580 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020872
VALIDATED
CNTN3 MISSION shRNA Bacterial Glycerol Stock
contactin 3 (plasmacytoma associated)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-4318s1c1
Sequence:CCGGGCTGCTGACTTTGATATGTATCTCGAGATACATATCAAAGTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-3107s1c1
Sequence:CCGGCCACCCTATGTCAAGTTATATCTCGAGATATAACTTGACATAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-111s1c1
Sequence:CCGGCTTTCATTCATTGGCTGCTTACTCGAGTAAGCAGCCAATGAATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020872.1-2527s1c1
Sequence:CCGGCCTCAGAAATTGAGGTTTCATCTCGAGATGAAACCTCAATTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020872.1-4841s1c1
Sequence:CCGGGCTCTATTGTTTCATGTTGTTCTCGAGAACAACATGAAACAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020872
VALIDATED
CNTN3 MISSION shRNA shRNA Plasmid DNA
contactin 3 (plasmacytoma associated)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-4318s1c1
Sequence:CCGGGCTGCTGACTTTGATATGTATCTCGAGATACATATCAAAGTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-3107s1c1
Sequence:CCGGCCACCCTATGTCAAGTTATATCTCGAGATATAACTTGACATAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-111s1c1
Sequence:CCGGCTTTCATTCATTGGCTGCTTACTCGAGTAAGCAGCCAATGAATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020872.1-2527s1c1
Sequence:CCGGCCTCAGAAATTGAGGTTTCATCTCGAGATGAAACCTCAATTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020872.1-4841s1c1
Sequence:CCGGGCTCTATTGTTTCATGTTGTTCTCGAGAACAACATGAAACAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020872
VALIDATED
CNTN3 MISSION shRNA Lentiviral Transduction Particles
contactin 3 (plasmacytoma associated)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-4318s1c1
Sequence:CCGGGCTGCTGACTTTGATATGTATCTCGAGATACATATCAAAGTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-3107s1c1
Sequence:CCGGCCACCCTATGTCAAGTTATATCTCGAGATATAACTTGACATAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020872.1-111s1c1
Sequence:CCGGCTTTCATTCATTGGCTGCTTACTCGAGTAAGCAGCCAATGAATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020872.1-2527s1c1
Sequence:CCGGCCTCAGAAATTGAGGTTTCATCTCGAGATGAAACCTCAATTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020872.1-4841s1c1
Sequence:CCGGGCTCTATTGTTTCATGTTGTTCTCGAGAACAACATGAAACAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008779
CNTN3 MISSION shRNA Bacterial Glycerol Stock
contactin 3 (plasmacytoma associated)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-795s1c1
Sequence:CCGGCGGTGACAAATACCAGAGTATCTCGAGATACTCTGGTATTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-3207s1c1
Sequence:CCGGCCATTTCTAACATCCACCCTTCTCGAGAAGGGTGGATGTTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-1303s1c1
Sequence:CCGGCCTTACAATAACCAACCTCAACTCGAGTTGAGGTTGGTTATTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-304s1c1
Sequence:CCGGCCCTGTTGATTCAGAGGACAACTCGAGTTGTCCTCTGAATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-3220s1c1
Sequence:CCGGCCACCCTTTGTCAGGTTATATCTCGAGATATAACCTGACAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008779
CNTN3 MISSION shRNA shRNA Plasmid DNA
contactin 3 (plasmacytoma associated)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-795s1c1
Sequence:CCGGCGGTGACAAATACCAGAGTATCTCGAGATACTCTGGTATTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-3207s1c1
Sequence:CCGGCCATTTCTAACATCCACCCTTCTCGAGAAGGGTGGATGTTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-1303s1c1
Sequence:CCGGCCTTACAATAACCAACCTCAACTCGAGTTGAGGTTGGTTATTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-304s1c1
Sequence:CCGGCCCTGTTGATTCAGAGGACAACTCGAGTTGTCCTCTGAATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-3220s1c1
Sequence:CCGGCCACCCTTTGTCAGGTTATATCTCGAGATATAACCTGACAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008779
CNTN3 MISSION shRNA Lentiviral Transduction Particles
contactin 3 (plasmacytoma associated)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-795s1c1
Sequence:CCGGCGGTGACAAATACCAGAGTATCTCGAGATACTCTGGTATTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-3207s1c1
Sequence:CCGGCCATTTCTAACATCCACCCTTCTCGAGAAGGGTGGATGTTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-1303s1c1
Sequence:CCGGCCTTACAATAACCAACCTCAACTCGAGTTGAGGTTGGTTATTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-304s1c1
Sequence:CCGGCCCTGTTGATTCAGAGGACAACTCGAGTTGTCCTCTGAATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008779.1-3220s1c1
Sequence:CCGGCCACCCTTTGTCAGGTTATATCTCGAGATATAACCTGACAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks