EMAIL THIS PAGE TO A FRIEND

CNTN4

contactin 4

212 Gene Product Result for
Synonyms: AXCAM BIG-2
UniProtKB ID: Q8IWV2, B2RAX3, Q8IX14, Q8TC35
Gene ID:
Human(152330) Summary: This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
Mouse(269784) contactin 4
Rat(116658) contactin 4
Zebrafish(571349) contactin 4
chicken(396149) contactin 4
dog(100686094) contactin 4
Horse(100053060) contactin 4
cow(521772) contactin 4
sheep(101112093) contactin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151491 MISSION® esiRNA esiRNA human CNTN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175607 Rosetta Predictions human pricing
NM_175612 Rosetta Predictions human pricing
NM_175613 Rosetta Predictions human pricing
NM_053879 Rosetta Predictions rat pricing
NM_001109749 Rosetta Predictions mouse pricing
NM_001109751 Rosetta Predictions mouse pricing
NM_173004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217636 predicted 2639
2 SASI_Hs01_00217638 predicted 3179
3 SASI_Hs02_00369008 predicted 2979
4 SASI_Hs01_00217639 predicted 3103
5 SASI_Hs01_00217640 predicted 3015
6 SASI_Hs01_00217641 predicted 2637
7 SASI_Hs01_00217642 predicted 2643
8 SASI_Hs01_00217643 predicted 2838
9 SASI_Hs01_00217644 predicted 2996
10 SASI_Hs01_00217645 predicted 2889
11 SASI_Hs01_00217637 predicted 3183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152159 predicted 664
2 SASI_Hs01_00152161 predicted 1208
3 SASI_Hs02_00369015 predicted 1007
4 SASI_Hs01_00152162 predicted 1135
5 SASI_Hs01_00152163 predicted 1043
6 SASI_Hs01_00152164 predicted 665
7 SASI_Hs01_00152165 predicted 671
8 SASI_Hs01_00152166 predicted 867
9 SASI_Hs01_00152167 predicted 1022
10 SASI_Hs01_00152168 predicted 919
11 SASI_Hs01_00152160 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023936 predicted 1495
2 SASI_Hs01_00023938 predicted 2043
3 SASI_Hs02_00369016 predicted 1845
4 SASI_Hs01_00023939 predicted 1964
5 SASI_Hs01_00023940 predicted 1886
6 SASI_Hs01_00023941 predicted 1498
7 SASI_Hs01_00023942 predicted 1509
8 SASI_Hs01_00023943 predicted 1697
9 SASI_Hs01_00023944 predicted 1855
10 SASI_Hs01_00023945 predicted 1748
11 SASI_Hs01_00023937 predicted 2048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066698 predicted 2692
2 SASI_Rn02_00266786 predicted 1745
3 SASI_Rn01_00066700 predicted 914
4 SASI_Rn01_00066701 predicted 475
5 SASI_Rn02_00266787 predicted 3383
6 SASI_Rn01_00066703 predicted 3515
7 SASI_Rn01_00066704 predicted 1515
8 SASI_Rn01_00066705 predicted 2089
9 SASI_Rn01_00066706 predicted 1152
10 SASI_Rn01_00066707 predicted 2011
11 SASI_Rn01_00066699 predicted 564
12 SASI_Rn01_00066702 predicted 1960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304244 predicted 2032
2 SASI_Mm02_00304245 predicted 1354
3 SASI_Mm02_00304246 predicted 2226
4 SASI_Mm02_00304247 predicted 1313
5 SASI_Mm02_00304248 predicted 2204
6 SASI_Mm02_00304249 predicted 994
7 SASI_Mm02_00304250 predicted 1891
8 SASI_Mm02_00304251 predicted 1595
9 SASI_Mm02_00304252 predicted 2169
10 SASI_Mm02_00304253 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304264 predicted 2121
2 SASI_Mm02_00304265 predicted 1444
3 SASI_Mm02_00304266 predicted 2311
4 SASI_Mm02_00304267 predicted 1405
5 SASI_Mm02_00304268 predicted 2296
6 SASI_Mm02_00304269 predicted 1079
7 SASI_Mm02_00304270 predicted 1971
8 SASI_Mm02_00304271 predicted 1680
9 SASI_Mm02_00304272 predicted 2252
10 SASI_Mm02_00304273 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345049 predicted 2036
2 SASI_Mm02_00345050 predicted 1352
3 SASI_Mm01_00142041 predicted 2227
4 SASI_Mm01_00142042 predicted 1313
5 SASI_Mm01_00142044 predicted 2204
6 SASI_Mm01_00142045 predicted 989
7 SASI_Mm02_00345051 predicted 1887
8 SASI_Mm01_00142046 predicted 1592
9 SASI_Mm01_00142047 predicted 2171
10 SASI_Mm01_00142048 predicted 803
11 SASI_Mm01_00142039 predicted 1378
12 SASI_Mm01_00142040 predicted 1538
13 SASI_Mm01_00142043 predicted 2454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175607
CNTN4 MISSION shRNA Bacterial Glycerol Stock
contactin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-1808s1c1
Sequence:CCGGCGTGTTTACTTGGTCATTTAACTCGAGTTAAATGACCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-1635s1c1
Sequence:CCGGGCTGGGAGTTATACCTGTATACTCGAGTATACAGGTATAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-321s1c1
Sequence:CCGGCCTGTAATGTTCCCTTTGGATCTCGAGATCCAAAGGGAACATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175607.1-3800s1c2
Sequence:CCGGCCGTAACTCAAGGCTGTTGTACTCGAGTACAACAGCCTTGAGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-2353s1c2
Sequence:CCGGGCAGCAAATCTGAACTGGTTACTCGAGTAACCAGTTCAGATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-3002s21c1
Sequence:CCGGGGATAATGAGTCGGAAGTAAACTCGAGTTTACTTCCGACTCATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-841s21c1
Sequence:CCGGGGCCACCTACACCACTAATATCTCGAGATATTAGTGGTGTAGGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-2844s21c1
Sequence:CCGGTTAGCTGTCAAGGCATATAATCTCGAGATTATATGCCTTGACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175607
CNTN4 MISSION shRNA shRNA Plasmid DNA
contactin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-1808s1c1
Sequence:CCGGCGTGTTTACTTGGTCATTTAACTCGAGTTAAATGACCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-1635s1c1
Sequence:CCGGGCTGGGAGTTATACCTGTATACTCGAGTATACAGGTATAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-321s1c1
Sequence:CCGGCCTGTAATGTTCCCTTTGGATCTCGAGATCCAAAGGGAACATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175607.1-3800s1c2
Sequence:CCGGCCGTAACTCAAGGCTGTTGTACTCGAGTACAACAGCCTTGAGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-2353s1c2
Sequence:CCGGGCAGCAAATCTGAACTGGTTACTCGAGTAACCAGTTCAGATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-3002s21c1
Sequence:CCGGGGATAATGAGTCGGAAGTAAACTCGAGTTTACTTCCGACTCATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-841s21c1
Sequence:CCGGGGCCACCTACACCACTAATATCTCGAGATATTAGTGGTGTAGGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-2844s21c1
Sequence:CCGGTTAGCTGTCAAGGCATATAATCTCGAGATTATATGCCTTGACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175607
CNTN4 MISSION shRNA Lentiviral Transduction Particles
contactin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-1808s1c1
Sequence:CCGGCGTGTTTACTTGGTCATTTAACTCGAGTTAAATGACCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-1635s1c1
Sequence:CCGGGCTGGGAGTTATACCTGTATACTCGAGTATACAGGTATAACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-321s1c1
Sequence:CCGGCCTGTAATGTTCCCTTTGGATCTCGAGATCCAAAGGGAACATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175607.1-3800s1c2
Sequence:CCGGCCGTAACTCAAGGCTGTTGTACTCGAGTACAACAGCCTTGAGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175607.1-2353s1c2
Sequence:CCGGGCAGCAAATCTGAACTGGTTACTCGAGTAACCAGTTCAGATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-3002s21c1
Sequence:CCGGGGATAATGAGTCGGAAGTAAACTCGAGTTTACTTCCGACTCATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-841s21c1
Sequence:CCGGGGCCACCTACACCACTAATATCTCGAGATATTAGTGGTGTAGGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175607.1-2844s21c1
Sequence:CCGGTTAGCTGTCAAGGCATATAATCTCGAGATTATATGCCTTGACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173004
CNTN4 MISSION shRNA Bacterial Glycerol Stock
contactin 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173004.1-2648s1c1
Sequence:CCGGCCTTCTTCTGAGAAGCCATTACTCGAGTAATGGCTTCTCAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-2397s1c1
Sequence:CCGGGCAGTCAATACAGTTCCAGATCTCGAGATCTGGAACTGTATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1881s1c1
Sequence:CCGGGCTGGAAGTTACACCTGCATACTCGAGTATGCAGGTGTAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1093s1c1
Sequence:CCGGCCACACCACTAATCCTGAGAACTCGAGTTCTCAGGATTAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1278s1c1
Sequence:CCGGGCCAGAAGACATAAGTCGAATCTCGAGATTCGACTTATGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1683s21c1
Sequence:CCGGAGCGCTGAGCTTAGTGTAATACTCGAGTATTACACTAAGCTCAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-701s21c1
Sequence:CCGGTGTTGACATTGGTATGGATTTCTCGAGAAATCCATACCAATGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1591s21c1
Sequence:CCGGAGCAAGGAACACTCAACATAACTCGAGTTATGTTGAGTGTTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1249s21c1
Sequence:CCGGGAAATCCAGTCCCAACTATTCCTCGAGGAATAGTTGGGACTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173004
CNTN4 MISSION shRNA shRNA Plasmid DNA
contactin 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173004.1-2648s1c1
Sequence:CCGGCCTTCTTCTGAGAAGCCATTACTCGAGTAATGGCTTCTCAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-2397s1c1
Sequence:CCGGGCAGTCAATACAGTTCCAGATCTCGAGATCTGGAACTGTATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1881s1c1
Sequence:CCGGGCTGGAAGTTACACCTGCATACTCGAGTATGCAGGTGTAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1093s1c1
Sequence:CCGGCCACACCACTAATCCTGAGAACTCGAGTTCTCAGGATTAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1278s1c1
Sequence:CCGGGCCAGAAGACATAAGTCGAATCTCGAGATTCGACTTATGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1683s21c1
Sequence:CCGGAGCGCTGAGCTTAGTGTAATACTCGAGTATTACACTAAGCTCAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-701s21c1
Sequence:CCGGTGTTGACATTGGTATGGATTTCTCGAGAAATCCATACCAATGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1591s21c1
Sequence:CCGGAGCAAGGAACACTCAACATAACTCGAGTTATGTTGAGTGTTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1249s21c1
Sequence:CCGGGAAATCCAGTCCCAACTATTCCTCGAGGAATAGTTGGGACTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173004
CNTN4 MISSION shRNA Lentiviral Transduction Particles
contactin 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173004.1-2648s1c1
Sequence:CCGGCCTTCTTCTGAGAAGCCATTACTCGAGTAATGGCTTCTCAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-2397s1c1
Sequence:CCGGGCAGTCAATACAGTTCCAGATCTCGAGATCTGGAACTGTATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1881s1c1
Sequence:CCGGGCTGGAAGTTACACCTGCATACTCGAGTATGCAGGTGTAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1093s1c1
Sequence:CCGGCCACACCACTAATCCTGAGAACTCGAGTTCTCAGGATTAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173004.1-1278s1c1
Sequence:CCGGGCCAGAAGACATAAGTCGAATCTCGAGATTCGACTTATGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1683s21c1
Sequence:CCGGAGCGCTGAGCTTAGTGTAATACTCGAGTATTACACTAAGCTCAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-701s21c1
Sequence:CCGGTGTTGACATTGGTATGGATTTCTCGAGAAATCCATACCAATGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1591s21c1
Sequence:CCGGAGCAAGGAACACTCAACATAACTCGAGTTATGTTGAGTGTTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173004.3-1249s21c1
Sequence:CCGGGAAATCCAGTCCCAACTATTCCTCGAGGAATAGTTGGGACTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks