EMAIL THIS PAGE TO A FRIEND

CNTN5

contactin 5

Synonyms: HNB-2s NB-2
UniProtKB ID: O94779, A1L4P0, B7ZM07, E9PKE8, O94780, Q49AF3
Gene ID:
Human(53942) Summary: The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(244682) contactin 5
Rat(114589) contactin 5
Zebrafish(327429) contactin 5
chicken(395317) contactin 5
cow(538198) contactin 5
Horse(100061138) contactin 5
dog(485109) contactin 5
sheep(101121624) contactin 5
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014361 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_905108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_905108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_905108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023841 MISSION® esiRNA esiRNA human CNTN5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014361 Rosetta Predictions human pricing
NM_175566 Rosetta Predictions human pricing
NM_053746 Rosetta Predictions rat pricing
XM_579576 Rosetta Predictions rat pricing
XM_905108 Rosetta Predictions mouse pricing
XM_974864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345505 predicted 1116
2 SASI_Hs01_00026614 predicted 2012
3 SASI_Hs01_00026615 predicted 840
4 SASI_Hs01_00026616 predicted 2171
5 SASI_Hs02_00345506 predicted 2126
6 SASI_Hs01_00026617 predicted 1915
7 SASI_Hs01_00026619 predicted 2550
8 SASI_Hs01_00026620 predicted 2276
9 SASI_Hs01_00026621 predicted 3153
10 SASI_Hs02_00345507 predicted 1291
11 SASI_Hs01_00026618 predicted 3696
12 SASI_Hs01_00026622 predicted 2645
13 SASI_Hs01_00026623 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368993 predicted 898
2 SASI_Hs01_00178975 predicted 1789
3 SASI_Hs01_00178976 predicted 615
4 SASI_Hs01_00178977 predicted 1952
5 SASI_Hs02_00368994 predicted 1902
6 SASI_Hs01_00178978 predicted 1693
7 SASI_Hs01_00178980 predicted 2322
8 SASI_Hs01_00178981 predicted 2048
9 SASI_Hs01_00178982 predicted 2929
10 SASI_Hs02_00368995 predicted 1067
11 SASI_Hs01_00178979 predicted 3464
12 SASI_Hs01_00178983 predicted 2422
13 SASI_Hs01_00178984 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266528 predicted 617
2 SASI_Rn01_00098498 predicted 302
3 SASI_Rn01_00098499 predicted 558
4 SASI_Rn01_00098501 predicted 1604
5 SASI_Rn02_00266529 predicted 2321
6 SASI_Rn01_00098502 predicted 1039
7 SASI_Rn01_00098503 predicted 1950
8 SASI_Rn01_00098506 predicted 1632
9 SASI_Rn01_00098507 predicted 1026
10 SASI_Rn02_00266530 predicted 2042
11 SASI_Rn01_00098500 predicted 1029
12 SASI_Rn01_00098504 predicted 1942
13 SASI_Rn01_00098505 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181101 predicted 1440
2 SASI_Rn01_00181102 predicted 1660
3 SASI_Rn01_00181103 predicted 1527
4 SASI_Rn01_00181104 predicted 1660
5 SASI_Rn01_00181105 predicted 1528
6 SASI_Rn01_00181106 predicted 1429
7 SASI_Rn01_00181107 predicted 1345
8 SASI_Rn01_00181108 predicted 1562
9 SASI_Rn01_00181109 predicted 1407
10 SASI_Rn01_00181110 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431492 predicted 1007
2 SASI_Mm02_00431493 predicted 340
3 SASI_Mm02_00431494 predicted 1637
4 SASI_Mm02_00431495 predicted 2089
5 SASI_Mm02_00431496 predicted 1996
6 SASI_Mm02_00431497 predicted 467
7 SASI_Mm02_00431498 predicted 1977
8 SASI_Mm02_00431499 predicted 1068
9 SASI_Mm02_00431500 predicted 1963
10 SASI_Mm02_00431501 predicted 2913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445442 predicted 1009
2 SASI_Mm01_00206237 predicted 342
3 SASI_Mm01_00206238 predicted 1642
4 SASI_Mm01_00206239 predicted 2085
5 SASI_Mm01_00206240 predicted 1990
6 SASI_Mm01_00206241 predicted 468
7 SASI_Mm01_00206242 predicted 1985
8 SASI_Mm02_00445443 predicted 1072
9 SASI_Mm01_00206245 predicted 1970
10 SASI_Mm02_00445444 predicted 2905
11 SASI_Mm01_00206243 predicted 3285
12 SASI_Mm01_00206244 predicted 3169
13 SASI_Mm01_00206246 predicted 3250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014361
CNTN5 MISSION shRNA Bacterial Glycerol Stock
contactin 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-2056s21c1
Sequence:CCGGAGGATAGAACTTACTCCTAAACTCGAGTTTAGGAGTAAGTTCTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-1016s21c1
Sequence:CCGGTCATCTATAGCTGGGTATTTACTCGAGTAAATACCCAGCTATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-2881s21c1
Sequence:CCGGGAAGTGAAAGTTGGCGTTTATCTCGAGATAAACGCCAACTTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-3121s21c1
Sequence:CCGGACTAGAGGGAATGAGTCTTTCCTCGAGGAAAGACTCATTCCCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-1639s21c1
Sequence:CCGGAGTAGGGTTGAGATGGTTAATCTCGAGATTAACCATCTCAACCCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2018s1c1
Sequence:CCGGCTGAAATTATAGCTTCGCTATCTCGAGATAGCGAAGCTATAATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2669s1c1
Sequence:CCGGCCACCAATGTAAGCGGAAGAACTCGAGTTCTTCCGCTTACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-380s1c1
Sequence:CCGGCCATGTGTCTTTCAGAGTATTCTCGAGAATACTCTGAAAGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2017s1c1
Sequence:CCGGGCTGAAATTATAGCTTCGCTACTCGAGTAGCGAAGCTATAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014361.2-3689s1c1
Sequence:CCGGCGGTGAATAGAGTGTAGTGTACTCGAGTACACTACACTCTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014361
CNTN5 MISSION shRNA shRNA Plasmid DNA
contactin 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-2056s21c1
Sequence:CCGGAGGATAGAACTTACTCCTAAACTCGAGTTTAGGAGTAAGTTCTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-1016s21c1
Sequence:CCGGTCATCTATAGCTGGGTATTTACTCGAGTAAATACCCAGCTATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-2881s21c1
Sequence:CCGGGAAGTGAAAGTTGGCGTTTATCTCGAGATAAACGCCAACTTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-3121s21c1
Sequence:CCGGACTAGAGGGAATGAGTCTTTCCTCGAGGAAAGACTCATTCCCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-1639s21c1
Sequence:CCGGAGTAGGGTTGAGATGGTTAATCTCGAGATTAACCATCTCAACCCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2018s1c1
Sequence:CCGGCTGAAATTATAGCTTCGCTATCTCGAGATAGCGAAGCTATAATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2669s1c1
Sequence:CCGGCCACCAATGTAAGCGGAAGAACTCGAGTTCTTCCGCTTACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-380s1c1
Sequence:CCGGCCATGTGTCTTTCAGAGTATTCTCGAGAATACTCTGAAAGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2017s1c1
Sequence:CCGGGCTGAAATTATAGCTTCGCTACTCGAGTAGCGAAGCTATAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014361.2-3689s1c1
Sequence:CCGGCGGTGAATAGAGTGTAGTGTACTCGAGTACACTACACTCTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014361
CNTN5 MISSION shRNA Lentiviral Transduction Particles
contactin 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-2056s21c1
Sequence:CCGGAGGATAGAACTTACTCCTAAACTCGAGTTTAGGAGTAAGTTCTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-1016s21c1
Sequence:CCGGTCATCTATAGCTGGGTATTTACTCGAGTAAATACCCAGCTATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-2881s21c1
Sequence:CCGGGAAGTGAAAGTTGGCGTTTATCTCGAGATAAACGCCAACTTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-3121s21c1
Sequence:CCGGACTAGAGGGAATGAGTCTTTCCTCGAGGAAAGACTCATTCCCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014361.2-1639s21c1
Sequence:CCGGAGTAGGGTTGAGATGGTTAATCTCGAGATTAACCATCTCAACCCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2018s1c1
Sequence:CCGGCTGAAATTATAGCTTCGCTATCTCGAGATAGCGAAGCTATAATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2669s1c1
Sequence:CCGGCCACCAATGTAAGCGGAAGAACTCGAGTTCTTCCGCTTACATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-380s1c1
Sequence:CCGGCCATGTGTCTTTCAGAGTATTCTCGAGAATACTCTGAAAGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014361.2-2017s1c1
Sequence:CCGGGCTGAAATTATAGCTTCGCTACTCGAGTAGCGAAGCTATAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014361.2-3689s1c1
Sequence:CCGGCGGTGAATAGAGTGTAGTGTACTCGAGTACACTACACTCTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_905108
CNTN5 MISSION shRNA Bacterial Glycerol Stock
contactin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1617s21c1
Sequence:CCGGCAAGGCAGTGAGGGCGAATAACTCGAGTTATTCGCCCTCACTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1088s21c1
Sequence:CCGGGTAAGTCCAGACTGCGGAAATCTCGAGATTTCCGCAGTCTGGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1777s21c1
Sequence:CCGGAGGATAGAGCTTACTCCTAAACTCGAGTTTAGGAGTAAGCTCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-439s21c1
Sequence:CCGGGGCAACCCATCTCCTAGTTACCTCGAGGTAACTAGGAGATGGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1141s21c1
Sequence:CCGGCTGGATGATGCCGGAATATACCTCGAGGTATATTCCGGCATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_905108
CNTN5 MISSION shRNA shRNA Plasmid DNA
contactin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1617s21c1
Sequence:CCGGCAAGGCAGTGAGGGCGAATAACTCGAGTTATTCGCCCTCACTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1088s21c1
Sequence:CCGGGTAAGTCCAGACTGCGGAAATCTCGAGATTTCCGCAGTCTGGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1777s21c1
Sequence:CCGGAGGATAGAGCTTACTCCTAAACTCGAGTTTAGGAGTAAGCTCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-439s21c1
Sequence:CCGGGGCAACCCATCTCCTAGTTACCTCGAGGTAACTAGGAGATGGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1141s21c1
Sequence:CCGGCTGGATGATGCCGGAATATACCTCGAGGTATATTCCGGCATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_905108
CNTN5 MISSION shRNA Lentiviral Transduction Particles
contactin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1617s21c1
Sequence:CCGGCAAGGCAGTGAGGGCGAATAACTCGAGTTATTCGCCCTCACTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1088s21c1
Sequence:CCGGGTAAGTCCAGACTGCGGAAATCTCGAGATTTCCGCAGTCTGGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1777s21c1
Sequence:CCGGAGGATAGAGCTTACTCCTAAACTCGAGTTTAGGAGTAAGCTCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-439s21c1
Sequence:CCGGGGCAACCCATCTCCTAGTTACCTCGAGGTAACTAGGAGATGGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_905108.3-1141s21c1
Sequence:CCGGCTGGATGATGCCGGAATATACCTCGAGGTATATTCCGGCATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks