EMAIL THIS PAGE TO A FRIEND

CNTN6

contactin 6

60 Gene Product Result for
Synonyms: NB3
UniProtKB ID: Q9UQ52, Q2KHM2
Gene ID:
Human(27255) Summary: The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. [provided by RefSeq, Jul 2008]
Mouse(53870) contactin 6
Rat(27256) contactin 6
sheep(101112602) contactin 6
chicken(427597) contactin 6
dog(484686) contactin 6
cow(533402) contactin 6
Horse(100053098) contactin 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011911 MISSION® esiRNA esiRNA targeting human CNTN6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014461 Rosetta Predictions human pricing
NM_013225 Rosetta Predictions rat pricing
NM_017383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078158 predicted 2005
2 SASI_Hs02_00345679 predicted 823
3 SASI_Hs02_00345680 predicted 2736
4 SASI_Hs02_00345681 predicted 2721
5 SASI_Hs01_00078160 predicted 530
6 SASI_Hs01_00078161 predicted 938
7 SASI_Hs01_00078163 predicted 2089
8 SASI_Hs01_00078164 predicted 402
9 SASI_Hs01_00078165 predicted 3130
10 SASI_Hs01_00078166 predicted 2254
11 SASI_Hs01_00078159 predicted 981
12 SASI_Hs01_00078162 predicted 2364
13 SASI_Hs01_00078167 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261108 predicted 2510
2 SASI_Rn01_00042794 predicted 525
3 SASI_Rn01_00042795 predicted 1731
4 SASI_Rn01_00042796 predicted 2857
5 SASI_Rn01_00042797 predicted 2278
6 SASI_Rn02_00261109 predicted 942
7 SASI_Rn01_00042798 predicted 863
8 SASI_Rn01_00042799 predicted 2772
9 SASI_Rn01_00042800 predicted 2846
10 SASI_Rn02_00261110 predicted 2947
11 SASI_Rn01_00042801 predicted 470
12 SASI_Rn01_00042802 predicted 1892
13 SASI_Rn01_00042803 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036254 predicted 1913
2 SASI_Mm01_00036255 predicted 514
3 SASI_Mm01_00036256 predicted 2914
4 SASI_Mm01_00036257 predicted 767
5 SASI_Mm01_00036258 predicted 989
6 SASI_Mm01_00036259 predicted 1693
7 SASI_Mm01_00036261 predicted 2304
8 SASI_Mm01_00036262 predicted 1297
9 SASI_Mm02_00323877 predicted 1132
10 SASI_Mm01_00036263 predicted 1747
11 SASI_Mm01_00036260 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014461
CNTN6 MISSION shRNA Bacterial Glycerol Stock
contactin 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-1846s1c1
Sequence:CCGGCCCTCCATTGAAGTGGTATTTCTCGAGAAATACCACTTCAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-2885s1c1
Sequence:CCGGCCATCTACTTTGCTTCCGTAACTCGAGTTACGGAAGCAAAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-1388s1c1
Sequence:CCGGCGATGCTGAATGTGTCAGATTCTCGAGAATCTGACACATTCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-2131s1c1
Sequence:CCGGCCAGATAATAACAGTCCCATTCTCGAGAATGGGACTGTTATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-1798s21c1
Sequence:CCGGGTTACAGTTGGCGAGAGTATACTCGAGTATACTCTCGCCAACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-2327s21c1
Sequence:CCGGGTGAACCATCAGAATTGTTAACTCGAGTTAACAATTCTGATGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-1187s21c1
Sequence:CCGGTTGCAAAGGGTCAACTCATTTCTCGAGAAATGAGTTGACCCTTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-2023s21c1
Sequence:CCGGTTATCTGCAGTAGCCGATATCCTCGAGGATATCGGCTACTGCAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014461
CNTN6 MISSION shRNA shRNA Plasmid DNA
contactin 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-1846s1c1
Sequence:CCGGCCCTCCATTGAAGTGGTATTTCTCGAGAAATACCACTTCAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-2885s1c1
Sequence:CCGGCCATCTACTTTGCTTCCGTAACTCGAGTTACGGAAGCAAAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-1388s1c1
Sequence:CCGGCGATGCTGAATGTGTCAGATTCTCGAGAATCTGACACATTCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-2131s1c1
Sequence:CCGGCCAGATAATAACAGTCCCATTCTCGAGAATGGGACTGTTATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-1798s21c1
Sequence:CCGGGTTACAGTTGGCGAGAGTATACTCGAGTATACTCTCGCCAACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-2327s21c1
Sequence:CCGGGTGAACCATCAGAATTGTTAACTCGAGTTAACAATTCTGATGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-1187s21c1
Sequence:CCGGTTGCAAAGGGTCAACTCATTTCTCGAGAAATGAGTTGACCCTTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-2023s21c1
Sequence:CCGGTTATCTGCAGTAGCCGATATCCTCGAGGATATCGGCTACTGCAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014461
CNTN6 MISSION shRNA Lentiviral Transduction Particles
contactin 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-1846s1c1
Sequence:CCGGCCCTCCATTGAAGTGGTATTTCTCGAGAAATACCACTTCAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-2885s1c1
Sequence:CCGGCCATCTACTTTGCTTCCGTAACTCGAGTTACGGAAGCAAAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-1388s1c1
Sequence:CCGGCGATGCTGAATGTGTCAGATTCTCGAGAATCTGACACATTCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014461.2-2131s1c1
Sequence:CCGGCCAGATAATAACAGTCCCATTCTCGAGAATGGGACTGTTATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-1798s21c1
Sequence:CCGGGTTACAGTTGGCGAGAGTATACTCGAGTATACTCTCGCCAACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-2327s21c1
Sequence:CCGGGTGAACCATCAGAATTGTTAACTCGAGTTAACAATTCTGATGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-1187s21c1
Sequence:CCGGTTGCAAAGGGTCAACTCATTTCTCGAGAAATGAGTTGACCCTTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014461.2-2023s21c1
Sequence:CCGGTTATCTGCAGTAGCCGATATCCTCGAGGATATCGGCTACTGCAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017383
CNTN6 MISSION shRNA Bacterial Glycerol Stock
contactin 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017383.3-3460s1c1
Sequence:CCGGCCAGCCTCTATCACAAGACATCTCGAGATGTCTTGTGATAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1702s1c1
Sequence:CCGGGCCTTAAGATATGCAATGTTACTCGAGTAACATTGCATATCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1029s1c1
Sequence:CCGGGCTGCAAAGGATTCATCTATACTCGAGTATAGATGAATCCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-2991s1c1
Sequence:CCGGCCAGTTAATGTCACCACCAAACTCGAGTTTGGTGGTGACATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1298s1c1
Sequence:CCGGCCTTTCTATCTATGACAGCTTCTCGAGAAGCTGTCATAGATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-376s21c1
Sequence:CCGGGTCGTTTCAGCCGTCCTATTTCTCGAGAAATAGGACGGCTGAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-2918s21c1
Sequence:CCGGACTAAGAGCTAATACGATTTACTCGAGTAAATCGTATTAGCTCTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-1801s21c1
Sequence:CCGGTGAAAGAGAGAACGATCATTACTCGAGTAATGATCGTTCTCTCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-587s21c1
Sequence:CCGGAGATCAAGATATTGGCATATACTCGAGTATATGCCAATATCTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017383
CNTN6 MISSION shRNA shRNA Plasmid DNA
contactin 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017383.3-3460s1c1
Sequence:CCGGCCAGCCTCTATCACAAGACATCTCGAGATGTCTTGTGATAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1702s1c1
Sequence:CCGGGCCTTAAGATATGCAATGTTACTCGAGTAACATTGCATATCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1029s1c1
Sequence:CCGGGCTGCAAAGGATTCATCTATACTCGAGTATAGATGAATCCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-2991s1c1
Sequence:CCGGCCAGTTAATGTCACCACCAAACTCGAGTTTGGTGGTGACATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1298s1c1
Sequence:CCGGCCTTTCTATCTATGACAGCTTCTCGAGAAGCTGTCATAGATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-376s21c1
Sequence:CCGGGTCGTTTCAGCCGTCCTATTTCTCGAGAAATAGGACGGCTGAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-2918s21c1
Sequence:CCGGACTAAGAGCTAATACGATTTACTCGAGTAAATCGTATTAGCTCTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-1801s21c1
Sequence:CCGGTGAAAGAGAGAACGATCATTACTCGAGTAATGATCGTTCTCTCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-587s21c1
Sequence:CCGGAGATCAAGATATTGGCATATACTCGAGTATATGCCAATATCTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017383
CNTN6 MISSION shRNA Lentiviral Transduction Particles
contactin 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017383.3-3460s1c1
Sequence:CCGGCCAGCCTCTATCACAAGACATCTCGAGATGTCTTGTGATAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1702s1c1
Sequence:CCGGGCCTTAAGATATGCAATGTTACTCGAGTAACATTGCATATCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1029s1c1
Sequence:CCGGGCTGCAAAGGATTCATCTATACTCGAGTATAGATGAATCCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-2991s1c1
Sequence:CCGGCCAGTTAATGTCACCACCAAACTCGAGTTTGGTGGTGACATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017383.3-1298s1c1
Sequence:CCGGCCTTTCTATCTATGACAGCTTCTCGAGAAGCTGTCATAGATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-376s21c1
Sequence:CCGGGTCGTTTCAGCCGTCCTATTTCTCGAGAAATAGGACGGCTGAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-2918s21c1
Sequence:CCGGACTAAGAGCTAATACGATTTACTCGAGTAAATCGTATTAGCTCTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-1801s21c1
Sequence:CCGGTGAAAGAGAGAACGATCATTACTCGAGTAATGATCGTTCTCTCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017383.3-587s21c1
Sequence:CCGGAGATCAAGATATTGGCATATACTCGAGTATATGCCAATATCTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks