EMAIL THIS PAGE TO A FRIEND

CNTNAP1

contactin associated protein 1

Synonyms: CASPR CNTNAP NRXN4 P190
UniProtKB ID: P78357
Gene ID:
Human(8506) Summary: The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
Mouse(53321) contactin associated protein-like 1
Rat(84008) contactin associated protein 1
Zebrafish(386706) contactin associated protein 1
chicken(428309) contactin associated protein 1
dog(490960) contactin associated protein 1
cow(540997) contactin associated protein 1
Horse(100052467) contactin associated protein 1
domestic cat(101099341) contactin associated protein 1
sheep(101111565) contactin associated protein 1
naked mole-rat(101714103) contactin associated protein 1
domestic guinea pig(100719034) contactin associated protein 1
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011772 Anti-CNTNAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2100459 Anti-CNTNAP1 antibody produced in rabbit affinity isolated antibody rat, rabbit, human, mouse, guinea pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003632 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003632 Rosetta Predictions human pricing
NM_032061 Rosetta Predictions rat pricing
NM_016782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170859 predicted 2541
2 SASI_Hs01_00170860 predicted 501
3 SASI_Hs01_00170861 predicted 3642
4 SASI_Hs01_00170862 predicted 2720
5 SASI_Hs01_00170863 predicted 3357
6 SASI_Hs01_00170865 predicted 702
7 SASI_Hs01_00170866 predicted 715
8 SASI_Hs01_00170867 predicted 1835
9 SASI_Hs01_00170868 predicted 348
10 SASI_Hs02_00335984 predicted 3338
11 SASI_Hs01_00170864 predicted 3211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265414 predicted 2860
2 SASI_Rn01_00114737 predicted 2485
3 SASI_Rn01_00114738 predicted 1389
4 SASI_Rn01_00114740 predicted 1975
5 SASI_Rn01_00114741 predicted 645
6 SASI_Rn01_00114742 predicted 214
7 SASI_Rn01_00114743 predicted 939
8 SASI_Rn02_00265415 predicted 2235
9 SASI_Rn02_00265416 predicted 1770
10 SASI_Rn01_00114746 predicted 2913
11 SASI_Rn01_00114739 predicted 3592
12 SASI_Rn01_00114744 predicted 1263
13 SASI_Rn01_00114745 predicted 3743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169735 predicted 2848
2 SASI_Mm01_00169736 predicted 2479
3 SASI_Mm01_00169737 predicted 2465
4 SASI_Mm01_00169738 predicted 1183
5 SASI_Mm01_00169739 predicted 3688
6 SASI_Mm01_00169740 predicted 3238
7 SASI_Mm02_00323560 predicted 554
8 SASI_Mm01_00169741 predicted 1973
9 SASI_Mm01_00169742 predicted 928
10 SASI_Mm01_00169743 predicted 1365
11 SASI_Mm01_00169744 predicted 3879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003632
CNTNAP1 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003632.2-3651s21c1
Sequence:CCGGCATCAATATCACCCGTGTTTACTCGAGTAAACACGGGTGATATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003632.2-2546s21c1
Sequence:CCGGGCTGCTATGGCGATCGAAATTCTCGAGAATTTCGATCGCCATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-3955s1c1
Sequence:CCGGCGAATCTAATTGCGGAGCTATCTCGAGATAGCTCCGCAATTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-3205s1c1
Sequence:CCGGCCACGATATTGGTGGTTTCTTCTCGAGAAGAAACCACCAATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-2045s1c1
Sequence:CCGGCCATTTGTAGTGTACTGTGATCTCGAGATCACAGTACACTACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-1195s1c1
Sequence:CCGGCGTAATCTTCAACCGCGTCAACTCGAGTTGACGCGGTTGAAGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-339s1c1
Sequence:CCGGCCTCCTACTACAGTCTCCTTACTCGAGTAAGGAGACTGTAGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003632
CNTNAP1 MISSION shRNA shRNA Plasmid DNA
contactin associated protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003632.2-3651s21c1
Sequence:CCGGCATCAATATCACCCGTGTTTACTCGAGTAAACACGGGTGATATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003632.2-2546s21c1
Sequence:CCGGGCTGCTATGGCGATCGAAATTCTCGAGAATTTCGATCGCCATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-3955s1c1
Sequence:CCGGCGAATCTAATTGCGGAGCTATCTCGAGATAGCTCCGCAATTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-3205s1c1
Sequence:CCGGCCACGATATTGGTGGTTTCTTCTCGAGAAGAAACCACCAATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-2045s1c1
Sequence:CCGGCCATTTGTAGTGTACTGTGATCTCGAGATCACAGTACACTACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-1195s1c1
Sequence:CCGGCGTAATCTTCAACCGCGTCAACTCGAGTTGACGCGGTTGAAGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-339s1c1
Sequence:CCGGCCTCCTACTACAGTCTCCTTACTCGAGTAAGGAGACTGTAGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003632
CNTNAP1 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003632.2-3651s21c1
Sequence:CCGGCATCAATATCACCCGTGTTTACTCGAGTAAACACGGGTGATATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003632.2-2546s21c1
Sequence:CCGGGCTGCTATGGCGATCGAAATTCTCGAGAATTTCGATCGCCATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-3955s1c1
Sequence:CCGGCGAATCTAATTGCGGAGCTATCTCGAGATAGCTCCGCAATTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-3205s1c1
Sequence:CCGGCCACGATATTGGTGGTTTCTTCTCGAGAAGAAACCACCAATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-2045s1c1
Sequence:CCGGCCATTTGTAGTGTACTGTGATCTCGAGATCACAGTACACTACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-1195s1c1
Sequence:CCGGCGTAATCTTCAACCGCGTCAACTCGAGTTGACGCGGTTGAAGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003632.1-339s1c1
Sequence:CCGGCCTCCTACTACAGTCTCCTTACTCGAGTAAGGAGACTGTAGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016782
CNTNAP1 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-1144s1c1
Sequence:CCGGCCGGATCAACATTGCAGAAATCTCGAGATTTCTGCAATGTTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-3991s1c1
Sequence:CCGGCGGATGGATTGCCATACTCTTCTCGAGAAGAGTATGGCAATCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-2572s1c1
Sequence:CCGGCCTCGATGTCTCATTCTACTTCTCGAGAAGTAGAATGAGACATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-3130s1c1
Sequence:CCGGGCCATACTGCAATCACGATATCTCGAGATATCGTGATTGCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-730s1c1
Sequence:CCGGCCAAAGTCTTTGGGACGTGTTCTCGAGAACACGTCCCAAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016782
CNTNAP1 MISSION shRNA shRNA Plasmid DNA
contactin associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-1144s1c1
Sequence:CCGGCCGGATCAACATTGCAGAAATCTCGAGATTTCTGCAATGTTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-3991s1c1
Sequence:CCGGCGGATGGATTGCCATACTCTTCTCGAGAAGAGTATGGCAATCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-2572s1c1
Sequence:CCGGCCTCGATGTCTCATTCTACTTCTCGAGAAGTAGAATGAGACATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-3130s1c1
Sequence:CCGGGCCATACTGCAATCACGATATCTCGAGATATCGTGATTGCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-730s1c1
Sequence:CCGGCCAAAGTCTTTGGGACGTGTTCTCGAGAACACGTCCCAAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016782
CNTNAP1 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-1144s1c1
Sequence:CCGGCCGGATCAACATTGCAGAAATCTCGAGATTTCTGCAATGTTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-3991s1c1
Sequence:CCGGCGGATGGATTGCCATACTCTTCTCGAGAAGAGTATGGCAATCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-2572s1c1
Sequence:CCGGCCTCGATGTCTCATTCTACTTCTCGAGAAGTAGAATGAGACATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-3130s1c1
Sequence:CCGGGCCATACTGCAATCACGATATCTCGAGATATCGTGATTGCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016782.1-730s1c1
Sequence:CCGGCCAAAGTCTTTGGGACGTGTTCTCGAGAACACGTCCCAAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks