EMAIL THIS PAGE TO A FRIEND

CNTNAP2

contactin associated protein-like 2

200 Gene Product Result for
Synonyms: AUTS15 CASPR2 CDFE NRXN4 PTHSL1
UniProtKB ID: Q9UHC6, D3DWG2, Q14DG2, Q52LV1, Q5H9Q7, Q9UQ12
Gene ID:
Human(26047) Summary: This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
Mouse(66797) contactin associated protein-like 2
Rat(500105) contactin associated protein-like 2
domestic guinea pig(100717858) contactin associated protein-like 2
sheep(101106322) contactin associated protein-like 2
Domestic Rabbit(100354524) contactin associated protein-like 2
chicken(768456) contactin associated protein-like 2
cow(516395) contactin associated protein-like 2
cow(100337375) contactin associated protein-like 2
Horse(100060296) contactin associated protein-like 2
domestic cat(101086795) contactin associated protein-like 2
dog(100687859) contactin associated protein-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1315 Human Caspr2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014141 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014141 Rosetta Predictions human pricing
XM_575456 Rosetta Predictions rat pricing
NM_001004357 Rosetta Predictions mouse pricing
NM_025771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345130 predicted 3827
2 SASI_Hs02_00345131 predicted 3512
3 SASI_Hs01_00150028 predicted 1832
4 SASI_Hs01_00150030 predicted 3805
5 SASI_Hs01_00150032 predicted 795
6 SASI_Hs01_00150034 predicted 833
7 SASI_Hs01_00150035 predicted 1281
8 SASI_Hs01_00150037 predicted 1527
9 SASI_Hs02_00345132 predicted 2158
10 SASI_Hs02_00345133 predicted 1408
11 SASI_Hs01_00150029 predicted 1252
12 SASI_Hs01_00150031 predicted 2068
13 SASI_Hs01_00150033 predicted 1085
14 SASI_Hs01_00150036 predicted 3860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403676 predicted 2424
2 SASI_Rn02_00403677 predicted 2297
3 SASI_Rn02_00403678 predicted 2364
4 SASI_Rn02_00403679 predicted 2170
5 SASI_Rn02_00403680 predicted 2304
6 SASI_Rn02_00403681 predicted 2175
7 SASI_Rn02_00403682 predicted 2452
8 SASI_Rn02_00403683 predicted 2418
9 SASI_Rn02_00403684 predicted 2434
10 SASI_Rn02_00403685 predicted 2449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165169 predicted 4682
2 SASI_Mm02_00286519 predicted 404
3 SASI_Mm02_00286520 predicted 1513
4 SASI_Mm02_00286521 predicted 1163
5 SASI_Mm02_00286522 predicted 539
6 SASI_Mm02_00286523 predicted 2441
7 SASI_Mm02_00286524 predicted 3519
8 SASI_Mm02_00286525 predicted 1488
9 SASI_Mm02_00286526 predicted 1236
10 SASI_Mm02_00286527 predicted 1412
11 SASI_Mm01_00165161 predicted 4553
12 SASI_Mm01_00165162 predicted 3888
13 SASI_Mm01_00165163 predicted 4492
14 SASI_Mm01_00165164 predicted 4659
15 SASI_Mm01_00165165 predicted 3897
16 SASI_Mm01_00165166 predicted 4652
17 SASI_Mm01_00165167 predicted 4512
18 SASI_Mm01_00165168 predicted 3950
19 SASI_Mm01_00165170 predicted 3927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085988 predicted 1127
2 SASI_Mm02_00328969 predicted 797
3 SASI_Mm01_00085981 predicted 355
4 SASI_Mm02_00328970 predicted 794
5 SASI_Mm01_00085984 predicted 365
6 SASI_Mm02_00328971 predicted 1114
7 SASI_Mm01_00085986 predicted 417
8 SASI_Mm01_00085989 predicted 396
9 SASI_Mm01_00085990 predicted 987
10 SASI_Mm02_00328972 predicted 452
11 SASI_Mm01_00085982 predicted 919
12 SASI_Mm01_00085983 predicted 1078
13 SASI_Mm01_00085985 predicted 943
14 SASI_Mm01_00085987 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025771
CNTNAP2 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025771.2-1028s1c1
Sequence:CCGGCCTCCGACATTCTCTTTCTTTCTCGAGAAAGAAAGAGAATGTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-396s1c1
Sequence:CCGGAGTCAACAGAAACTCAGCTATCTCGAGATAGCTGAGTTTCTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-477s1c1
Sequence:CCGGCCGGTACATGTTCCGTCACAACTCGAGTTGTGACGGAACATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-586s1c1
Sequence:CCGGGAGACCATTGACGAGAGCAAACTCGAGTTTGCTCTCGTCAATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-344s1c1
Sequence:CCGGCCAGTGCTGATTTCCCATATACTCGAGTATATGGGAAATCAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025771
CNTNAP2 MISSION shRNA shRNA Plasmid DNA
contactin associated protein-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025771.2-1028s1c1
Sequence:CCGGCCTCCGACATTCTCTTTCTTTCTCGAGAAAGAAAGAGAATGTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-396s1c1
Sequence:CCGGAGTCAACAGAAACTCAGCTATCTCGAGATAGCTGAGTTTCTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-477s1c1
Sequence:CCGGCCGGTACATGTTCCGTCACAACTCGAGTTGTGACGGAACATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-586s1c1
Sequence:CCGGGAGACCATTGACGAGAGCAAACTCGAGTTTGCTCTCGTCAATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-344s1c1
Sequence:CCGGCCAGTGCTGATTTCCCATATACTCGAGTATATGGGAAATCAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025771
CNTNAP2 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025771.2-1028s1c1
Sequence:CCGGCCTCCGACATTCTCTTTCTTTCTCGAGAAAGAAAGAGAATGTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-396s1c1
Sequence:CCGGAGTCAACAGAAACTCAGCTATCTCGAGATAGCTGAGTTTCTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-477s1c1
Sequence:CCGGCCGGTACATGTTCCGTCACAACTCGAGTTGTGACGGAACATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-586s1c1
Sequence:CCGGGAGACCATTGACGAGAGCAAACTCGAGTTTGCTCTCGTCAATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025771.2-344s1c1
Sequence:CCGGCCAGTGCTGATTTCCCATATACTCGAGTATATGGGAAATCAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014141
CNTNAP2 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein-like 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014141.3-5019s1c1
Sequence:CCGGGCCAGATGTTATGATTTGTTTCTCGAGAAACAAATCATAACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-3080s1c1
Sequence:CCGGCCTAGAGAGATACCACGGTTACTCGAGTAACCGTGGTATCTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-2185s1c1
Sequence:CCGGGCGAGCAGTATGTCTCCTATTCTCGAGAATAGGAGACATACTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-2186s1c1
Sequence:CCGGCGAGCAGTATGTCTCCTATTTCTCGAGAAATAGGAGACATACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014141.5-1839s21c1
Sequence:CCGGGATGAGCCAAATCGATATTTCCTCGAGGAAATATCGATTTGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014141.5-1538s21c1
Sequence:CCGGACTACAATGGCGTCAACATTACTCGAGTAATGTTGACGCCATTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014141
CNTNAP2 MISSION shRNA shRNA Plasmid DNA
contactin associated protein-like 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014141.3-5019s1c1
Sequence:CCGGGCCAGATGTTATGATTTGTTTCTCGAGAAACAAATCATAACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-3080s1c1
Sequence:CCGGCCTAGAGAGATACCACGGTTACTCGAGTAACCGTGGTATCTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-2185s1c1
Sequence:CCGGGCGAGCAGTATGTCTCCTATTCTCGAGAATAGGAGACATACTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-2186s1c1
Sequence:CCGGCGAGCAGTATGTCTCCTATTTCTCGAGAAATAGGAGACATACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014141.5-1839s21c1
Sequence:CCGGGATGAGCCAAATCGATATTTCCTCGAGGAAATATCGATTTGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014141.5-1538s21c1
Sequence:CCGGACTACAATGGCGTCAACATTACTCGAGTAATGTTGACGCCATTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014141
CNTNAP2 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein-like 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014141.3-5019s1c1
Sequence:CCGGGCCAGATGTTATGATTTGTTTCTCGAGAAACAAATCATAACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-3080s1c1
Sequence:CCGGCCTAGAGAGATACCACGGTTACTCGAGTAACCGTGGTATCTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-2185s1c1
Sequence:CCGGGCGAGCAGTATGTCTCCTATTCTCGAGAATAGGAGACATACTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014141.3-2186s1c1
Sequence:CCGGCGAGCAGTATGTCTCCTATTTCTCGAGAAATAGGAGACATACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014141.5-1839s21c1
Sequence:CCGGGATGAGCCAAATCGATATTTCCTCGAGGAAATATCGATTTGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014141.5-1538s21c1
Sequence:CCGGACTACAATGGCGTCAACATTACTCGAGTAATGTTGACGCCATTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks