EMAIL THIS PAGE TO A FRIEND

CNTNAP3

contactin associated protein-like 3

75 Gene Product Result for
Synonyms: CASPR3 CNTNAP3A RP11-138L21.1 RP11-290L7.1
UniProtKB ID: Q9BZ76, B1AMA0, Q9C0E9
Gene ID:
Human(79937) Summary: The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(238680) contactin associated protein-like 3
domestic cat(101096853) contactin associated protein-like 3
cow(784375) contactin associated protein-like 3
sheep(101123612) contactin associated protein-like 3
Domestic Rabbit(100345243) contactin associated protein-like 3
domestic guinea pig(100725022) contactin associated protein-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033655 Rosetta Predictions human pricing
NM_001081129 Rosetta Predictions mouse pricing
XM_138666 Rosetta Predictions mouse pricing
XM_983390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044765 predicted 927
2 SASI_Hs02_00361462 predicted 2520
3 SASI_Hs01_00044767 predicted 1858
4 SASI_Hs02_00361463 predicted 1480
5 SASI_Hs01_00044768 predicted 3637
6 SASI_Hs02_00361464 predicted 531
7 SASI_Hs01_00044770 predicted 2815
8 SASI_Hs01_00044771 predicted 3692
9 SASI_Hs01_00044772 predicted 838
10 SASI_Hs01_00044773 predicted 1295
11 SASI_Hs01_00044764 predicted 1410
12 SASI_Hs01_00044766 predicted 712
13 SASI_Hs01_00044769 predicted 4152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295471 predicted 3783
2 SASI_Mm02_00295472 predicted 2161
3 SASI_Mm02_00295473 predicted 3204
4 SASI_Mm02_00295474 predicted 959
5 SASI_Mm02_00295475 predicted 660
6 SASI_Mm02_00295476 predicted 3337
7 SASI_Mm02_00295477 predicted 798
8 SASI_Mm02_00295478 predicted 3401
9 SASI_Mm02_00295479 predicted 3704
10 SASI_Mm02_00295480 predicted 3352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248529 predicted 772
2 SASI_Mm01_00248530 predicted 819
3 SASI_Mm01_00248531 predicted 819
4 SASI_Mm01_00248532 predicted 355
5 SASI_Mm01_00248533 predicted 666
6 SASI_Mm01_00248534 predicted 811
7 SASI_Mm01_00248535 predicted 712
8 SASI_Mm01_00248536 predicted 567
9 SASI_Mm01_00248537 predicted 380
10 SASI_Mm01_00248538 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204583 predicted 1408
2 SASI_Mm01_00204584 predicted 1534
3 SASI_Mm01_00204585 predicted 896
4 SASI_Mm01_00204586 predicted 831
5 SASI_Mm01_00204587 predicted 965
6 SASI_Mm01_00204588 predicted 1091
7 SASI_Mm01_00204589 predicted 951
8 SASI_Mm01_00204590 predicted 1024
9 SASI_Mm01_00204591 predicted 1323
10 SASI_Mm01_00204592 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033655
VALIDATED
CNTNAP3 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein-like 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033655.3-4419s21c1
Sequence:CCGGGCAGTTTGATCTGTGTTAATACTCGAGTATTAACACAGATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033655.3-4324s21c1
Sequence:CCGGCACAGTCCTCCACATCAATTTCTCGAGAAATTGATGTGGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-758s21c1
Sequence:CCGGAGTGTACGGATGTGCATATAACTCGAGTTATATGCACATCCGTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3230s21c1
Sequence:CCGGCAATGAGATTTCCGCATATTTCTCGAGAAATATGCGGAAATCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-4027s21c1
Sequence:CCGGCCATAGCCATACGCATCTATCCTCGAGGATAGATGCGTATGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3987s21c1
Sequence:CCGGGTGATAGCAGTGGTGATATTTCTCGAGAAATATCACCACTGCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-1257s21c1
Sequence:CCGGGGAGTGGATGTTACCGAATTACTCGAGTAATTCGGTAACATCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-1139s21c1
Sequence:CCGGTTCCAGTTACTTGGATCTTAACTCGAGTTAAGATCCAAGTAACTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3384s21c1
Sequence:CCGGACACGAACTCCGAGCTTATTGCTCGAGCAATAAGCTCGGAGTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033655.2-4739s1c1
Sequence:CCGGGCCTGGAAACACTACCATTATCTCGAGATAATGGTAGTGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033655.2-1499s1c1
Sequence:CCGGCCTCTTTCTTAAGGATGGCAACTCGAGTTGCCATCCTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033655.2-3647s1c1
Sequence:CCGGCGCCGTCAAATCTCTCATATTCTCGAGAATATGAGAGATTTGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_033655.2-1444s1c1
Sequence:CCGGACAGAGCAGGACATTTGCTTTCTCGAGAAAGCAAATGTCCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033655.2-1296s1c1
Sequence:CCGGCAGATCCTCATGATGGGAAATCTCGAGATTTCCCATCATGAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033655
VALIDATED
CNTNAP3 MISSION shRNA shRNA Plasmid DNA
contactin associated protein-like 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033655.3-4419s21c1
Sequence:CCGGGCAGTTTGATCTGTGTTAATACTCGAGTATTAACACAGATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033655.3-4324s21c1
Sequence:CCGGCACAGTCCTCCACATCAATTTCTCGAGAAATTGATGTGGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-758s21c1
Sequence:CCGGAGTGTACGGATGTGCATATAACTCGAGTTATATGCACATCCGTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3230s21c1
Sequence:CCGGCAATGAGATTTCCGCATATTTCTCGAGAAATATGCGGAAATCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-4027s21c1
Sequence:CCGGCCATAGCCATACGCATCTATCCTCGAGGATAGATGCGTATGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3987s21c1
Sequence:CCGGGTGATAGCAGTGGTGATATTTCTCGAGAAATATCACCACTGCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-1257s21c1
Sequence:CCGGGGAGTGGATGTTACCGAATTACTCGAGTAATTCGGTAACATCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-1139s21c1
Sequence:CCGGTTCCAGTTACTTGGATCTTAACTCGAGTTAAGATCCAAGTAACTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3384s21c1
Sequence:CCGGACACGAACTCCGAGCTTATTGCTCGAGCAATAAGCTCGGAGTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033655.2-4739s1c1
Sequence:CCGGGCCTGGAAACACTACCATTATCTCGAGATAATGGTAGTGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033655.2-1499s1c1
Sequence:CCGGCCTCTTTCTTAAGGATGGCAACTCGAGTTGCCATCCTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033655.2-3647s1c1
Sequence:CCGGCGCCGTCAAATCTCTCATATTCTCGAGAATATGAGAGATTTGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_033655.2-1444s1c1
Sequence:CCGGACAGAGCAGGACATTTGCTTTCTCGAGAAAGCAAATGTCCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033655.2-1296s1c1
Sequence:CCGGCAGATCCTCATGATGGGAAATCTCGAGATTTCCCATCATGAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033655
VALIDATED
CNTNAP3 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein-like 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033655.3-4419s21c1
Sequence:CCGGGCAGTTTGATCTGTGTTAATACTCGAGTATTAACACAGATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033655.3-4324s21c1
Sequence:CCGGCACAGTCCTCCACATCAATTTCTCGAGAAATTGATGTGGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-758s21c1
Sequence:CCGGAGTGTACGGATGTGCATATAACTCGAGTTATATGCACATCCGTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3230s21c1
Sequence:CCGGCAATGAGATTTCCGCATATTTCTCGAGAAATATGCGGAAATCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-4027s21c1
Sequence:CCGGCCATAGCCATACGCATCTATCCTCGAGGATAGATGCGTATGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3987s21c1
Sequence:CCGGGTGATAGCAGTGGTGATATTTCTCGAGAAATATCACCACTGCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-1257s21c1
Sequence:CCGGGGAGTGGATGTTACCGAATTACTCGAGTAATTCGGTAACATCCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-1139s21c1
Sequence:CCGGTTCCAGTTACTTGGATCTTAACTCGAGTTAAGATCCAAGTAACTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033655.3-3384s21c1
Sequence:CCGGACACGAACTCCGAGCTTATTGCTCGAGCAATAAGCTCGGAGTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033655.2-4739s1c1
Sequence:CCGGGCCTGGAAACACTACCATTATCTCGAGATAATGGTAGTGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033655.2-1499s1c1
Sequence:CCGGCCTCTTTCTTAAGGATGGCAACTCGAGTTGCCATCCTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033655.2-3647s1c1
Sequence:CCGGCGCCGTCAAATCTCTCATATTCTCGAGAATATGAGAGATTTGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_033655.2-1444s1c1
Sequence:CCGGACAGAGCAGGACATTTGCTTTCTCGAGAAAGCAAATGTCCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033655.2-1296s1c1
Sequence:CCGGCAGATCCTCATGATGGGAAATCTCGAGATTTCCCATCATGAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081129
CNTNAP3 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-3361s21c1
Sequence:CCGGTTTCACCAGCTGACGATTAACCTCGAGGTTAATCGTCAGCTGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-662s21c1
Sequence:CCGGGACCAGTAAGAGAGGTTATTTCTCGAGAAATAACCTCTCTTACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081129.1-4545s21c1
Sequence:CCGGGCCAACTGTTTCTAATCATTTCTCGAGAAATGATTAGAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-699s21c1
Sequence:CCGGCATGCAGAACAGCGGGATTATCTCGAGATAATCCCGCTGTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-3074s21c1
Sequence:CCGGGTTCCTCAGTGACCTATAATTCTCGAGAATTATAGGTCACTGAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081129
CNTNAP3 MISSION shRNA shRNA Plasmid DNA
contactin associated protein-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-3361s21c1
Sequence:CCGGTTTCACCAGCTGACGATTAACCTCGAGGTTAATCGTCAGCTGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-662s21c1
Sequence:CCGGGACCAGTAAGAGAGGTTATTTCTCGAGAAATAACCTCTCTTACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081129.1-4545s21c1
Sequence:CCGGGCCAACTGTTTCTAATCATTTCTCGAGAAATGATTAGAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-699s21c1
Sequence:CCGGCATGCAGAACAGCGGGATTATCTCGAGATAATCCCGCTGTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-3074s21c1
Sequence:CCGGGTTCCTCAGTGACCTATAATTCTCGAGAATTATAGGTCACTGAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081129
CNTNAP3 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-3361s21c1
Sequence:CCGGTTTCACCAGCTGACGATTAACCTCGAGGTTAATCGTCAGCTGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-662s21c1
Sequence:CCGGGACCAGTAAGAGAGGTTATTTCTCGAGAAATAACCTCTCTTACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081129.1-4545s21c1
Sequence:CCGGGCCAACTGTTTCTAATCATTTCTCGAGAAATGATTAGAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-699s21c1
Sequence:CCGGCATGCAGAACAGCGGGATTATCTCGAGATAATCCCGCTGTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081129.1-3074s21c1
Sequence:CCGGGTTCCTCAGTGACCTATAATTCTCGAGAATTATAGGTCACTGAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks