EMAIL THIS PAGE TO A FRIEND

CNTNAP4

contactin associated protein-like 4

Synonyms: CASPR4
UniProtKB ID: Q9C0A0, E9PFZ6, Q86YZ7
Gene ID:
Human(85445) Summary: This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(170571) contactin associated protein-like 4
Rat(307865) contactin associated protein-like 4
chicken(430532) contactin associated protein-like 4
cow(536775) contactin associated protein-like 4
Horse(100064076) contactin associated protein-like 4
domestic cat(101097860) contactin associated protein-like 4
dog(479642) contactin associated protein-like 4
domestic guinea pig(100735104) contactin associated protein-like 4
naked mole-rat(101702380) contactin associated protein-like 4
sheep(101118808) contactin associated protein-like 4
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033401 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033401 Rosetta Predictions human pricing
NM_138994 Rosetta Predictions human pricing
NM_001107432 Rosetta Predictions rat pricing
NM_130457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202038 predicted 2138
2 SASI_Hs02_00361275 predicted 4307
3 SASI_Hs02_00361276 predicted 2662
4 SASI_Hs02_00361277 predicted 2814
5 SASI_Hs02_00361278 predicted 4026
6 SASI_Hs01_00202043 predicted 2124
7 SASI_Hs02_00361279 predicted 4104
8 SASI_Hs01_00202045 predicted 2091
9 SASI_Hs02_00361280 predicted 2757
10 SASI_Hs02_00361281 predicted 3507
11 SASI_Hs01_00202037 predicted 843
12 SASI_Hs01_00202039 predicted 564
13 SASI_Hs01_00202040 predicted 1246
14 SASI_Hs01_00202041 predicted 2035
15 SASI_Hs01_00202042 predicted 2138
16 SASI_Hs01_00202044 predicted 1861
17 SASI_Hs01_00202046 predicted 1912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085384 predicted 1590
2 SASI_Hs02_00364033 predicted 3756
3 SASI_Hs02_00364034 predicted 2118
4 SASI_Hs02_00364035 predicted 2271
5 SASI_Hs02_00364036 predicted 3488
6 SASI_Hs01_00085389 predicted 1578
7 SASI_Hs02_00364037 predicted 3556
8 SASI_Hs01_00085391 predicted 1542
9 SASI_Hs02_00364038 predicted 2212
10 SASI_Hs02_00364039 predicted 2959
11 SASI_Hs01_00085383 predicted 666
12 SASI_Hs01_00085385 predicted 382
13 SASI_Hs01_00085386 predicted 1075
14 SASI_Hs01_00085387 predicted 1847
15 SASI_Hs01_00085388 predicted 1965
16 SASI_Hs01_00085390 predicted 1679
17 SASI_Hs01_00085392 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228765 predicted 2375
2 SASI_Rn02_00228766 predicted 2007
3 SASI_Rn02_00228767 predicted 3660
4 SASI_Rn02_00228768 predicted 3334
5 SASI_Rn02_00228769 predicted 697
6 SASI_Rn02_00228770 predicted 780
7 SASI_Rn02_00228771 predicted 2343
8 SASI_Rn02_00228772 predicted 1950
9 SASI_Rn02_00228773 predicted 3284
10 SASI_Rn02_00228774 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172729 predicted 1895
2 SASI_Mm01_00172730 predicted 3320
3 SASI_Mm01_00172731 predicted 697
4 SASI_Mm01_00172732 predicted 3280
5 SASI_Mm01_00172733 predicted 784
6 SASI_Mm01_00172734 predicted 3169
7 SASI_Mm02_00338266 predicted 3834
8 SASI_Mm01_00172735 predicted 2057
9 SASI_Mm01_00172736 predicted 2101
10 SASI_Mm01_00172737 predicted 1870
11 SASI_Mm01_00172738 predicted 4005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033401
CNTNAP4 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein-like 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033401.2-4252s1c1
Sequence:CCGGCATAGCATTCATTCTATGGAACTCGAGTTCCATAGAATGAATGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-2426s1c1
Sequence:CCGGCCAGTAACTAAGATCGTGATTCTCGAGAATCACGATCTTAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-2545s1c1
Sequence:CCGGCGAGGCTTCATATCTTCATTTCTCGAGAAATGAAGATATGAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-1996s1c1
Sequence:CCGGCCTGGAACCATTTCTTCTATACTCGAGTATAGAAGAAATGGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-589s1c1
Sequence:CCGGGCCTTCTATCAAAGCCAGATTCTCGAGAATCTGGCTTTGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033401
CNTNAP4 MISSION shRNA shRNA Plasmid DNA
contactin associated protein-like 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033401.2-4252s1c1
Sequence:CCGGCATAGCATTCATTCTATGGAACTCGAGTTCCATAGAATGAATGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-2426s1c1
Sequence:CCGGCCAGTAACTAAGATCGTGATTCTCGAGAATCACGATCTTAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-2545s1c1
Sequence:CCGGCGAGGCTTCATATCTTCATTTCTCGAGAAATGAAGATATGAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-1996s1c1
Sequence:CCGGCCTGGAACCATTTCTTCTATACTCGAGTATAGAAGAAATGGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-589s1c1
Sequence:CCGGGCCTTCTATCAAAGCCAGATTCTCGAGAATCTGGCTTTGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033401
CNTNAP4 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein-like 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033401.2-4252s1c1
Sequence:CCGGCATAGCATTCATTCTATGGAACTCGAGTTCCATAGAATGAATGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-2426s1c1
Sequence:CCGGCCAGTAACTAAGATCGTGATTCTCGAGAATCACGATCTTAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-2545s1c1
Sequence:CCGGCGAGGCTTCATATCTTCATTTCTCGAGAAATGAAGATATGAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-1996s1c1
Sequence:CCGGCCTGGAACCATTTCTTCTATACTCGAGTATAGAAGAAATGGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033401.2-589s1c1
Sequence:CCGGGCCTTCTATCAAAGCCAGATTCTCGAGAATCTGGCTTTGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130457
CNTNAP4 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein-like 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130457.2-4451s1c1
Sequence:CCGGGCCTGGAAATGCTTCTGAGATCTCGAGATCTCAGAAGCATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-2376s1c1
Sequence:CCGGCCTGTCACTAAGATTGTGATTCTCGAGAATCACAATCTTAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-2160s1c1
Sequence:CCGGCGCCTCGTTAATCAGCAAGATCTCGAGATCTTGCTGATTAACGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-3606s1c1
Sequence:CCGGGCAGTGCAGTTCAGCCATATTCTCGAGAATATGGCTGAACTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-3329s21c1
Sequence:CCGGGATACGATACAAGCTAAATAACTCGAGTTATTTAGCTTGTATCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-703s21c1
Sequence:CCGGGTCCAATAAGAGATATCATATCTCGAGATATGATATCTCTTATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-2288s21c1
Sequence:CCGGCATTGATGCCCAGTATCATTGCTCGAGCAATGATACTGGGCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130457
CNTNAP4 MISSION shRNA shRNA Plasmid DNA
contactin associated protein-like 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130457.2-4451s1c1
Sequence:CCGGGCCTGGAAATGCTTCTGAGATCTCGAGATCTCAGAAGCATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-2376s1c1
Sequence:CCGGCCTGTCACTAAGATTGTGATTCTCGAGAATCACAATCTTAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-2160s1c1
Sequence:CCGGCGCCTCGTTAATCAGCAAGATCTCGAGATCTTGCTGATTAACGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-3606s1c1
Sequence:CCGGGCAGTGCAGTTCAGCCATATTCTCGAGAATATGGCTGAACTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-3329s21c1
Sequence:CCGGGATACGATACAAGCTAAATAACTCGAGTTATTTAGCTTGTATCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-703s21c1
Sequence:CCGGGTCCAATAAGAGATATCATATCTCGAGATATGATATCTCTTATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-2288s21c1
Sequence:CCGGCATTGATGCCCAGTATCATTGCTCGAGCAATGATACTGGGCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130457
CNTNAP4 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein-like 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130457.2-4451s1c1
Sequence:CCGGGCCTGGAAATGCTTCTGAGATCTCGAGATCTCAGAAGCATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-2376s1c1
Sequence:CCGGCCTGTCACTAAGATTGTGATTCTCGAGAATCACAATCTTAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-2160s1c1
Sequence:CCGGCGCCTCGTTAATCAGCAAGATCTCGAGATCTTGCTGATTAACGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130457.2-3606s1c1
Sequence:CCGGGCAGTGCAGTTCAGCCATATTCTCGAGAATATGGCTGAACTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-3329s21c1
Sequence:CCGGGATACGATACAAGCTAAATAACTCGAGTTATTTAGCTTGTATCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-703s21c1
Sequence:CCGGGTCCAATAAGAGATATCATATCTCGAGATATGATATCTCTTATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130457.2-2288s21c1
Sequence:CCGGCATTGATGCCCAGTATCATTGCTCGAGCAATGATACTGGGCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks