EMAIL THIS PAGE TO A FRIEND

CNTNAP5

contactin associated protein-like 5

Synonyms: caspr5
Gene ID:
Human(129684) Summary: This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
naked mole-rat(101721163) contactin associated protein-like 5
domestic guinea pig(100721475) contactin associated protein-like 5
Zebrafish(798019) contactin associated protein-like 5
cow(100336611) contactin associated protein-like 5
Horse(100050788) contactin associated protein-like 5
domestic cat(101098396) contactin associated protein-like 5
dog(483874) contactin associated protein-like 5
chicken(424231) contactin associated protein-like 5
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130773 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065231 MISSION® esiRNA esiRNA human CNTNAP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130773 Rosetta Predictions human pricing
NM_138996 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362803 predicted 4043
2 SASI_Hs02_00362804 predicted 3717
3 SASI_Hs01_00219683 predicted 932
4 SASI_Hs01_00219684 predicted 1532
5 SASI_Hs01_00219686 predicted 671
6 SASI_Hs01_00219687 predicted 2786
7 SASI_Hs01_00219688 predicted 441
8 SASI_Hs02_00362805 predicted 3149
9 SASI_Hs02_00362806 predicted 612
10 SASI_Hs01_00219689 predicted 1398
11 SASI_Hs01_00219682 predicted 2931
12 SASI_Hs01_00219685 predicted 1271
13 SASI_Hs01_00219690 predicted 1559
14 SASI_Hs01_00219691 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223513 predicted 2934
2 SASI_Hs01_00223514 predicted 941
3 SASI_Hs01_00223515 predicted 1531
4 SASI_Hs01_00223516 predicted 1268
5 SASI_Hs01_00223517 predicted 680
6 SASI_Hs01_00223518 predicted 2787
7 SASI_Hs01_00223519 predicted 455
8 SASI_Hs01_00223520 predicted 1404
9 SASI_Hs01_00223521 predicted 1554
10 SASI_Hs01_00223522 predicted 1979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130773
CNTNAP5 MISSION shRNA Bacterial Glycerol Stock
contactin associated protein-like 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130773.2-2657s21c1
Sequence:CCGGACTGATACCGACAGATCAAACCTCGAGGTTTGATCTGTCGGTATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130773.2-4997s1c1
Sequence:CCGGGCATGGAAATAGCAGCTTGAACTCGAGTTCAAGCTGCTATTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-3747s1c1
Sequence:CCGGCGGAAGTAGAGTTCAGGGTTACTCGAGTAACCCTGAACTCTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-1802s1c1
Sequence:CCGGGTGCAGATTTATTCTGGAAATCTCGAGATTTCCAGAATAAATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-437s1c1
Sequence:CCGGGCGACAAACTACAACTGTGATCTCGAGATCACAGTTGTAGTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-4257s1c1
Sequence:CCGGGCGAGTGTAAACGGGAATATTCTCGAGAATATTCCCGTTTACACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130773
CNTNAP5 MISSION shRNA shRNA Plasmid DNA
contactin associated protein-like 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130773.2-2657s21c1
Sequence:CCGGACTGATACCGACAGATCAAACCTCGAGGTTTGATCTGTCGGTATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130773.2-4997s1c1
Sequence:CCGGGCATGGAAATAGCAGCTTGAACTCGAGTTCAAGCTGCTATTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-3747s1c1
Sequence:CCGGCGGAAGTAGAGTTCAGGGTTACTCGAGTAACCCTGAACTCTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-1802s1c1
Sequence:CCGGGTGCAGATTTATTCTGGAAATCTCGAGATTTCCAGAATAAATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-437s1c1
Sequence:CCGGGCGACAAACTACAACTGTGATCTCGAGATCACAGTTGTAGTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-4257s1c1
Sequence:CCGGGCGAGTGTAAACGGGAATATTCTCGAGAATATTCCCGTTTACACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130773
CNTNAP5 MISSION shRNA Lentiviral Transduction Particles
contactin associated protein-like 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130773.2-2657s21c1
Sequence:CCGGACTGATACCGACAGATCAAACCTCGAGGTTTGATCTGTCGGTATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130773.2-4997s1c1
Sequence:CCGGGCATGGAAATAGCAGCTTGAACTCGAGTTCAAGCTGCTATTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-3747s1c1
Sequence:CCGGCGGAAGTAGAGTTCAGGGTTACTCGAGTAACCCTGAACTCTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-1802s1c1
Sequence:CCGGGTGCAGATTTATTCTGGAAATCTCGAGATTTCCAGAATAAATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-437s1c1
Sequence:CCGGGCGACAAACTACAACTGTGATCTCGAGATCACAGTTGTAGTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130773.2-4257s1c1
Sequence:CCGGGCGAGTGTAAACGGGAATATTCTCGAGAATATTCCCGTTTACACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks